Thursday, April 29, 2004
More Serious Journalism from a Respected News Source
For All Youse Romantics
Scandal In Port Stephens!!!
Apparently God has been subtly rigging the polls at Port Stephens to get the desired results:
West Ward Councillor Sally Dover told the new Port Stephens Council at its first meeting whether they believed it or not, they had been appointed by God.
Scandalous! Shocking! Stupefying! (etc etc) This God person must be stopped immediately before he destroys the foundations of our democracy!
(Story via the Port Stephens Examiner. Link unavailable online.)
West Ward Councillor Sally Dover told the new Port Stephens Council at its first meeting whether they believed it or not, they had been appointed by God.
Scandalous! Shocking! Stupefying! (etc etc) This God person must be stopped immediately before he destroys the foundations of our democracy!
(Story via the Port Stephens Examiner. Link unavailable online.)
Wednesday, April 28, 2004
As Usual, I'm Confused
According to a story picked up by Al-Hayat, members of Al-Qaeda working for Al-Zarqawi have been found in Jordan with WMD that probably came from Jordan that may have come from Iraq that may have been the very Weapons of Mass Destruction that George Bush was looking for. Anyway, it's all very important. Read story here.
Uh... would someone please massage my brain?
Uh... would someone please massage my brain?
Sarcasm Alert!!!
Washington, Tuesday - in a move that has shocked nobody, President of the USA, George Bush, has announced: "I was wrong and the hippies were right. I should never have invaded Iraq. I should have realised, what the Iraqi people need is love, not war. War has never solved anything."
When questioned by journalists what caused this sudden turn-around in policy, Mr. Bush said, "It had to happen sometime. I mean, I've been manipulated by the patriarchal system for a long time now, but last week I met a hippy who turned my whole view on the matter around.
"He said that I needed to get back in touch with Mother Earth, and he was right. It's time to get back to the gentle, nurturing, female values, and away from the masculinist violence inherent in the capitalist economy."
Mr. Bush then invited journalists onto the stage and they had a big group hug.
Hippies have welcomed George Bush's announcement. "It's about time he realised we were right," said one member of Greenpeace.
"Yeah," said another, "War never solved anything. Make love, not war. Man. - Uh, what was it we were talking about again?"
As a follow-up to his announcement, George Bush has released Saddam Hussein from imprisonment and apologised to him for the little misunderstanding.
"You can have your country back if you like, but try not to kill anyone, hmmmn?" he said.
Mr. Bush could not be contacted today. He was too busy meditating at a Buddhist retreat in Texas.
When questioned by journalists what caused this sudden turn-around in policy, Mr. Bush said, "It had to happen sometime. I mean, I've been manipulated by the patriarchal system for a long time now, but last week I met a hippy who turned my whole view on the matter around.
"He said that I needed to get back in touch with Mother Earth, and he was right. It's time to get back to the gentle, nurturing, female values, and away from the masculinist violence inherent in the capitalist economy."
Mr. Bush then invited journalists onto the stage and they had a big group hug.
Hippies have welcomed George Bush's announcement. "It's about time he realised we were right," said one member of Greenpeace.
"Yeah," said another, "War never solved anything. Make love, not war. Man. - Uh, what was it we were talking about again?"
As a follow-up to his announcement, George Bush has released Saddam Hussein from imprisonment and apologised to him for the little misunderstanding.
"You can have your country back if you like, but try not to kill anyone, hmmmn?" he said.
Mr. Bush could not be contacted today. He was too busy meditating at a Buddhist retreat in Texas.
Day of the Day
You've had word of the day, quote of the day, man of the day, and time of the day - so why not day of the day? Novocastria is pleased to announce that the day of the day today is:
Wednesday! It's just 24 hours after Tuesday, and 24 hours before Thursday. It's wedged neatly in the middle of the week, a median day, a not-quite day, a day that's unsure whether it's beginning or ending, but definitely not Monday or Friday. Ladies and gentlemen, put your hands together for - WEDNESDAY!
Wednesday! It's just 24 hours after Tuesday, and 24 hours before Thursday. It's wedged neatly in the middle of the week, a median day, a not-quite day, a day that's unsure whether it's beginning or ending, but definitely not Monday or Friday. Ladies and gentlemen, put your hands together for - WEDNESDAY!
What Year That Wrong Isn't?
Harry Hutton at Chase Me Ladies records an incomprehensible conversation with a student:
"How to say [in English] trouser," he asked, "but isn't trouser?"
"Huh?" I said.
"Isn't trouser. What it is?"
I had a similar experience yesterday. Matt, a young kid I know, asks me:
"If I was 22, what year would it be?"
"2004", I reply.
"No!" he shoots back. "I mean, how old would I be?"
"22", I say. "Obviously."
"No!" he says again. "If this year was 2004, what year would I be born in?"
"I don't know," I said. Because, naturally, I didn't.
After some further discussion, it turns out that this is the question he wants to ask: "If I was 22 years old, what year would I be born in?" To which the answer, of course, is 1982 or 1981, and I told him so.
Don't worry, Matt! Even the best of us get up mixed sometimes a little things!
"How to say [in English] trouser," he asked, "but isn't trouser?"
"Huh?" I said.
"Isn't trouser. What it is?"
I had a similar experience yesterday. Matt, a young kid I know, asks me:
"If I was 22, what year would it be?"
"2004", I reply.
"No!" he shoots back. "I mean, how old would I be?"
"22", I say. "Obviously."
"No!" he says again. "If this year was 2004, what year would I be born in?"
"I don't know," I said. Because, naturally, I didn't.
After some further discussion, it turns out that this is the question he wants to ask: "If I was 22 years old, what year would I be born in?" To which the answer, of course, is 1982 or 1981, and I told him so.
Don't worry, Matt! Even the best of us get up mixed sometimes a little things!
Fidel Diddled
Fake humanitarian Fidel Castro must be feeling real stupid after holding a real 25-minute phone conversation with a fake Hugo Chavez:
Two Miami radio journalists were fined $5,463 dollars for broadcasting a phone conversation that fooled Cuban President Fidel Castro into believing he was talking with Venezuelan President Hugo Chavez.
Joe Ferrero and Enrique Santos, of Spanish-language radio station "El Zol" called the fine absurd and promised to pay a whopping bag of pennies to the Federal Communications Commission in Washington.
Later in the article:
In June, the pair, who host a humour show, managed to fake Chavez's voice and were put through to Castro, who maintained a conversation with the phone-y Chavez, a political ally, for 25 minutes, before the Miami-based radio host doing the voice said, "So -- you agree that your island is in deep shit?
"You fell for it!" he shouted.
"What did I fall for you shit-eater ... you faggot!" an irate Castro shot back, in addition to some choice insults making reference to the mother of the caller.
They were fined for this? They should get an award. There's still more in the article, so go read.
Two Miami radio journalists were fined $5,463 dollars for broadcasting a phone conversation that fooled Cuban President Fidel Castro into believing he was talking with Venezuelan President Hugo Chavez.
Joe Ferrero and Enrique Santos, of Spanish-language radio station "El Zol" called the fine absurd and promised to pay a whopping bag of pennies to the Federal Communications Commission in Washington.
Later in the article:
In June, the pair, who host a humour show, managed to fake Chavez's voice and were put through to Castro, who maintained a conversation with the phone-y Chavez, a political ally, for 25 minutes, before the Miami-based radio host doing the voice said, "So -- you agree that your island is in deep shit?
"You fell for it!" he shouted.
"What did I fall for you shit-eater ... you faggot!" an irate Castro shot back, in addition to some choice insults making reference to the mother of the caller.
They were fined for this? They should get an award. There's still more in the article, so go read.
Just When You Thought You'd Heard the Last of the Plastic Turkeys...
Monday, April 26, 2004
Spectator Inspected
Do great magazines die, or do they just go on and on?
Tim Blair links to Mark Steyn and Denis Boyles, who both claim to see a decline in the quality of journalism over at The Spectator, the mouthpiece for Conservative Britain. His readers seem to agree.
Of course, they have in mind the most recent issue, which published articles by Andrew Gilligan, Sam Kiley and Rod Liddle, all strongly critical of the coalition effort in Iraq.
The articles make good points, though many might doubt the conclusions that they come to. Of the three, the worst is the piece by Rod Liddle, which claims that the Iraqi people would have been better off under Saddam Hussein and the Baath party; but then, anyone who has been reading the Spectator regularly will know that Rod Liddle is fond of making such controversial statements, in the hope of provoking debate. He's the sort of writer you read for rhetoric, not research; for entertainment more than information.
The critics also ignore this article, by Michael Gove, which excoriates the anti-war press, or, for that matter, the follow-up pieces by Mark Steyn and William Shawcross in this week's issue.
All this is quite in order for the magazine, which regularly publishes articles containing views contrary to its editorial position. It's fond of controversy and debate, and since I subscribed to it last year, I've come to expect this of it. In fact, the magazine supported the war, though over the past year, they've come to have important differences with the pro-war Labor party. Some time ago, they published a leader titled "Right War - Wrong Reasons", neatly summing up their objections to the Blairists.
It seems to me that critics of the Spectator expect the magazine to publish articles only agreeing with their point of view. But surely the Spectator, in publishing articles critical of the coalition effort, are in fact doing the coalition a valuable service? If it's important to give credit where credit is due, it is certainly just as important to give criticism when something is done wrong.
Then again, it may be that the Spectator is obsessively 'anti-Blair' - but then, what is to be expected of a Tory journal, which has in the past year published contributions by John Major and Iain Duncan-Smith, and is edited by a Tory MP? It's not a magazine you go to for objective journalism; it's more like a weekly collection of 'Opinion' columns.
The Spectator may be many things, but on the basis of its recent performance, it's certainly not in decline.
Tim Blair links to Mark Steyn and Denis Boyles, who both claim to see a decline in the quality of journalism over at The Spectator, the mouthpiece for Conservative Britain. His readers seem to agree.
Of course, they have in mind the most recent issue, which published articles by Andrew Gilligan, Sam Kiley and Rod Liddle, all strongly critical of the coalition effort in Iraq.
The articles make good points, though many might doubt the conclusions that they come to. Of the three, the worst is the piece by Rod Liddle, which claims that the Iraqi people would have been better off under Saddam Hussein and the Baath party; but then, anyone who has been reading the Spectator regularly will know that Rod Liddle is fond of making such controversial statements, in the hope of provoking debate. He's the sort of writer you read for rhetoric, not research; for entertainment more than information.
The critics also ignore this article, by Michael Gove, which excoriates the anti-war press, or, for that matter, the follow-up pieces by Mark Steyn and William Shawcross in this week's issue.
All this is quite in order for the magazine, which regularly publishes articles containing views contrary to its editorial position. It's fond of controversy and debate, and since I subscribed to it last year, I've come to expect this of it. In fact, the magazine supported the war, though over the past year, they've come to have important differences with the pro-war Labor party. Some time ago, they published a leader titled "Right War - Wrong Reasons", neatly summing up their objections to the Blairists.
It seems to me that critics of the Spectator expect the magazine to publish articles only agreeing with their point of view. But surely the Spectator, in publishing articles critical of the coalition effort, are in fact doing the coalition a valuable service? If it's important to give credit where credit is due, it is certainly just as important to give criticism when something is done wrong.
Then again, it may be that the Spectator is obsessively 'anti-Blair' - but then, what is to be expected of a Tory journal, which has in the past year published contributions by John Major and Iain Duncan-Smith, and is edited by a Tory MP? It's not a magazine you go to for objective journalism; it's more like a weekly collection of 'Opinion' columns.
The Spectator may be many things, but on the basis of its recent performance, it's certainly not in decline.
New Blog
Tim Blair alerts us to an entertaining new blog, Chase Me Ladies! It's only a week old, but it's already clocked up an impressive list of bad puns, entertaining stories, killer facts, meditations on the state of the statuary in London, and several innovative dating techniques. I think I'll be following this blog regularly.
Sunday, April 25, 2004
Breaking News
Paul and Carl have an exciting scoop on the new series of Big Brother about to go to air. Click here for the details!
They also get the dirt on a frightening group of terrorists - the notorious Al-gebra movement.
Why go to a respectable news source when you can get your daily dose of lies for free at P&C's Daily Diatribe?
They also get the dirt on a frightening group of terrorists - the notorious Al-gebra movement.
Why go to a respectable news source when you can get your daily dose of lies for free at P&C's Daily Diatribe?
Shocking News! Bradd Pitt has sex change!
... or at least that's what this link on msn suggests.
"Win a girl's night out with Brad Pitt".
In other news, I spotted an advertisement from the Sydney Symphony Orchestra in yesterday's Australian; seems they're looking for a publisist! Yep! You heard me right! I wonder if they meant it?
"Win a girl's night out with Brad Pitt".
In other news, I spotted an advertisement from the Sydney Symphony Orchestra in yesterday's Australian; seems they're looking for a publisist! Yep! You heard me right! I wonder if they meant it?
Monday, April 19, 2004
Postus Scriptum
Tim Dunlop writes:
I did actually write a long post yesterday but I somehow banished it to electronic oblivion and despite lengthy attempts to retrieve it, I failed miserably. It's a shame too because it was probably the best post I've ever written and may well have been the best post anyone has ever written. It captured my thinking on a number of topics and expressed it in the sort of imaginative but sparse prose that I like best. You would have laughed out loud at some of the analogies I used. It included links to rare but apposite material from all around the web and brought it all together in such a way that the whole was greater than the sum of the parts. It was funny and insightful, and struck just the right balance between optimism and reluctant realism. Not one word was wasted and I'm sure that even if you'd disagreed with my conclusions you would have conceded the worthiness of my reasoning and perhaps have even been swayed by the case I put forward.
Isn't it always the case?
I did actually write a long post yesterday but I somehow banished it to electronic oblivion and despite lengthy attempts to retrieve it, I failed miserably. It's a shame too because it was probably the best post I've ever written and may well have been the best post anyone has ever written. It captured my thinking on a number of topics and expressed it in the sort of imaginative but sparse prose that I like best. You would have laughed out loud at some of the analogies I used. It included links to rare but apposite material from all around the web and brought it all together in such a way that the whole was greater than the sum of the parts. It was funny and insightful, and struck just the right balance between optimism and reluctant realism. Not one word was wasted and I'm sure that even if you'd disagreed with my conclusions you would have conceded the worthiness of my reasoning and perhaps have even been swayed by the case I put forward.
Isn't it always the case?
Sunday, April 18, 2004
APE RAPE!
Let's take a look at this little article by Peter Singer about bonking beasts....
At a conference on great apes a few years ago, I spoke to a woman who had visited Camp Leakey, a rehabilitation center for captured orangutans in Borneo run by Birute Galdikas, sometimes referred to as "the Jane Goodall of orangutans" and the world's foremost authority on these great apes. At Camp Leakey, the orangutans are gradually acclimatised to the jungle, and as they get closer to complete independence, they are able to come and go as they please. While walking through the camp with Galdikas, my informant was suddenly seized by a large male orangutan, his intentions made obvious by his erect penis. Fighting off so powerful an animal was not an option, but Galdikas called to her companion not to be concerned, because the orangutan would not harm her, and adding, as further reassurance, that "they have a very small penis." As it happened, the orangutan lost interest before penetration took place...
You have to wonder what life is like amongst these oh-so-permissive orangutangologists...
"Where's Doctor Leakey?"
"Oh, she's just off fucking the orangutangs."
"She's WHAT?"
"Don't worry. They have a small penis, she can't get hurt."
"But ... but ... that's so wrong!"
"I know, I know, but as they say, it's not the size that matters, it's the way you use it!"
At a conference on great apes a few years ago, I spoke to a woman who had visited Camp Leakey, a rehabilitation center for captured orangutans in Borneo run by Birute Galdikas, sometimes referred to as "the Jane Goodall of orangutans" and the world's foremost authority on these great apes. At Camp Leakey, the orangutans are gradually acclimatised to the jungle, and as they get closer to complete independence, they are able to come and go as they please. While walking through the camp with Galdikas, my informant was suddenly seized by a large male orangutan, his intentions made obvious by his erect penis. Fighting off so powerful an animal was not an option, but Galdikas called to her companion not to be concerned, because the orangutan would not harm her, and adding, as further reassurance, that "they have a very small penis." As it happened, the orangutan lost interest before penetration took place...
You have to wonder what life is like amongst these oh-so-permissive orangutangologists...
"Where's Doctor Leakey?"
"Oh, she's just off fucking the orangutangs."
"She's WHAT?"
"Don't worry. They have a small penis, she can't get hurt."
"But ... but ... that's so wrong!"
"I know, I know, but as they say, it's not the size that matters, it's the way you use it!"
Saturday, April 17, 2004
Bloguretics
Some Updates from the World of Blog.
The Rat Pack have a caption competition underway; head on over and make a caption of your own. Joy likes knitting; her third post inspires a fascinating comments thread over at Tim Blair's blog. Staying over at Blair's Blog, we find Tim looking at a piece on Professor Singer about George Bush that ... well, this is what it says: "Professor Singer said Mr Bush was wrong to go to war in Afghanistan (he suggested that a truly Christian leader would have "turned the other cheek" when America was attacked on September 11, 2001) because it led to the loss of innocent life." Tim seems to think we should turn another cheek to Singer. Andrew Sullivan wants a tax on petrol; Iowahawk locates the first draft of Andrew Sullivan's article. The GnuHunter, meanwhile, thinks Iowahawk is pretty damn good and makes him a blog of the week. Tex brings us bizarre quote of the week. And Slatts brings us the quote of the day:
The Italian hostage executed in Iraq tried to tear off his hood seconds before he was shot dead and screamed: "Now I'll show you how an Italian dies."
The Rat Pack have a caption competition underway; head on over and make a caption of your own. Joy likes knitting; her third post inspires a fascinating comments thread over at Tim Blair's blog. Staying over at Blair's Blog, we find Tim looking at a piece on Professor Singer about George Bush that ... well, this is what it says: "Professor Singer said Mr Bush was wrong to go to war in Afghanistan (he suggested that a truly Christian leader would have "turned the other cheek" when America was attacked on September 11, 2001) because it led to the loss of innocent life." Tim seems to think we should turn another cheek to Singer. Andrew Sullivan wants a tax on petrol; Iowahawk locates the first draft of Andrew Sullivan's article. The GnuHunter, meanwhile, thinks Iowahawk is pretty damn good and makes him a blog of the week. Tex brings us bizarre quote of the week. And Slatts brings us the quote of the day:
The Italian hostage executed in Iraq tried to tear off his hood seconds before he was shot dead and screamed: "Now I'll show you how an Italian dies."
Media Botches
Tim Blair is on a roll. Read his excellent dissection of Donna Mulhearn's account of being taken 'hostage', and then this post, where he catches Margo Kingston out.
I wonder if the ABC's Media Watch will pick up on these?
I wonder if the ABC's Media Watch will pick up on these?
Thursday, April 15, 2004
ATSIC Given the Flick
From Tim Blair comes the news that PM John Howard has announced the end of ATSIC.
Branding the experiment in elected representation for indigenous people a "failure", Mr Howard said the Aboriginal and Torres Strait Islander Commission would be abolished within months and not replaced.
But Labor got there first.
March 30, 2004 - 4:47PM
Opposition leader Mark Latham said today a Labor government would abolish Australia's peak indigenous body ATSIC - the Aboriginal and Torres Strait Islander Commission.
Would John Howard have been brave enough to make this decision without Labor's prompting? I doubt it. It would have been too easy to portray the Coalition as racist, and unscrupulous left-leaning politicians would have made a meal out of right-wing opponents.
Branding the experiment in elected representation for indigenous people a "failure", Mr Howard said the Aboriginal and Torres Strait Islander Commission would be abolished within months and not replaced.
But Labor got there first.
March 30, 2004 - 4:47PM
Opposition leader Mark Latham said today a Labor government would abolish Australia's peak indigenous body ATSIC - the Aboriginal and Torres Strait Islander Commission.
Would John Howard have been brave enough to make this decision without Labor's prompting? I doubt it. It would have been too easy to portray the Coalition as racist, and unscrupulous left-leaning politicians would have made a meal out of right-wing opponents.
Tuesday, April 13, 2004
Bloetry 2
Charles Austin, proprietor of the blog Sine Qua Non, blows us away with the following bloem, full of juicy, linky goodness:
Nibblin' on cheesesteak,
With Swiss for Pete's sake,
Protestors screaming, "No blood for oil."
Strummin' my six string,
On my own jet, schwing!
Mental shrimps, they're beginning to spoil.
Wasted away again listening to James Carville,
Searching for my lost sense of gestalt.
Some people claim that I've got no sense of shame,
But I know, it's all George Bush's fault.
Here's a campaign bomb!
I served in Vietnam,
Committing atrocities, but just a few.
My wife's a rich beauty,
A Portuguese cutie.
Wonder if Mahathir knows I'm a Jew?
Wasted away again prostrate 'fore Bill and Hill,
Searching for my lost sense of gestalt.
Some people claim there's always George Bush to blame,
Now I think, hell it could be my fault.
Tried out my flip flops,
Fell and blew my top,
At my private ski slope back home.
But there's booze in the blender,
So Teddy can render,
The spin with Tim Russert that helps me hang on.
Wasted away again here in JohnKerryVille,
Searching for my lost sense of gestalt.
Some people claim I'll lose 'cause my campaign's lame,
And I know, it's my own damn fault.
Original, insightful, and fucking brilliant!
Nibblin' on cheesesteak,
With Swiss for Pete's sake,
Protestors screaming, "No blood for oil."
Strummin' my six string,
On my own jet, schwing!
Mental shrimps, they're beginning to spoil.
Wasted away again listening to James Carville,
Searching for my lost sense of gestalt.
Some people claim that I've got no sense of shame,
But I know, it's all George Bush's fault.
Here's a campaign bomb!
I served in Vietnam,
Committing atrocities, but just a few.
My wife's a rich beauty,
A Portuguese cutie.
Wonder if Mahathir knows I'm a Jew?
Wasted away again prostrate 'fore Bill and Hill,
Searching for my lost sense of gestalt.
Some people claim there's always George Bush to blame,
Now I think, hell it could be my fault.
Tried out my flip flops,
Fell and blew my top,
At my private ski slope back home.
But there's booze in the blender,
So Teddy can render,
The spin with Tim Russert that helps me hang on.
Wasted away again here in JohnKerryVille,
Searching for my lost sense of gestalt.
Some people claim I'll lose 'cause my campaign's lame,
And I know, it's my own damn fault.
Original, insightful, and fucking brilliant!
Monday, April 12, 2004
Bolt and Salman
BOLT: I'm talking to you as probably our most influential Muslim educator. And you're speaking to someone widely regarded by Muslim spokesmen as . . .
SALMAN: A Muslim basher.
The opening of an interview between Andrew Bolt and Dr. Salah Salman, head of the King Khalid Islamic college. "We parted all smiles," writes Bolt, "although I doubt I reassured Salman much. Him I found charming, informed and eloquent, yet not quite as reassuring as I'd hoped, either. Maybe what still divides us isn't ignorance, but something more stubborn. See what you think."
Not that Bolt was the only one to be asking the hard questions:
You never condemn targeted killing by Israelis or the bulldozing of houses with women and children inside. Or the targeting of one terrorist, with the killing of 20 innocents around him. Why don't you try to see both sides? You never criticise anti-Muslims.
Fascinating. Read the whole thing.
SALMAN: A Muslim basher.
The opening of an interview between Andrew Bolt and Dr. Salah Salman, head of the King Khalid Islamic college. "We parted all smiles," writes Bolt, "although I doubt I reassured Salman much. Him I found charming, informed and eloquent, yet not quite as reassuring as I'd hoped, either. Maybe what still divides us isn't ignorance, but something more stubborn. See what you think."
Not that Bolt was the only one to be asking the hard questions:
You never condemn targeted killing by Israelis or the bulldozing of houses with women and children inside. Or the targeting of one terrorist, with the killing of 20 innocents around him. Why don't you try to see both sides? You never criticise anti-Muslims.
Fascinating. Read the whole thing.
Philipism
Philip Adams - the left-wing loony the right loves to hate - in a longer column about Ralph Nader mentions this interesting episode:
Burnet, one of Australia’s greatest scientists, was arguing with Gorton who, slightly pissed, was talking about his plans (fortunately unrealised) for Australia to "go nuclear" in power generation. The Nobel Laureate rattled off objection after objection. Radioactivity would cause innumerable cases of leukaemia, a fact emphasised by his wife’s silent presence. There was no safe way to store nuclear waste. Worse still, any nuclear power plant would, in due course, provide a perfect target for terrorists.
As I mentioned before, Philip Adams is a skeptic. Phil, have you spoken with the Australian Skeptics lately? Check in with fellow skeptic Colin Keay, and then tell us again that you're not swallowing the propaganda of the anti-nuclear nuts hook, line and sinker.
Burnet, one of Australia’s greatest scientists, was arguing with Gorton who, slightly pissed, was talking about his plans (fortunately unrealised) for Australia to "go nuclear" in power generation. The Nobel Laureate rattled off objection after objection. Radioactivity would cause innumerable cases of leukaemia, a fact emphasised by his wife’s silent presence. There was no safe way to store nuclear waste. Worse still, any nuclear power plant would, in due course, provide a perfect target for terrorists.
As I mentioned before, Philip Adams is a skeptic. Phil, have you spoken with the Australian Skeptics lately? Check in with fellow skeptic Colin Keay, and then tell us again that you're not swallowing the propaganda of the anti-nuclear nuts hook, line and sinker.
Eat your Greens, but not too much
Spoken like a true meatitarian: Peter Lalor writing in The Australian today...
I'VE never met a vegetarian I liked. Believe me, I've met my share and have more than an intimate knowledge of the subject having closely researched it for the best part of 15 years.
The mung bean mafia are generally prone to flatulence, have poor personal hygiene, make terrible dinner companions and share a gastronomic gene pool with those disposed toward mass murder and violence. And quite possibly fat.
I'VE never met a vegetarian I liked. Believe me, I've met my share and have more than an intimate knowledge of the subject having closely researched it for the best part of 15 years.
The mung bean mafia are generally prone to flatulence, have poor personal hygiene, make terrible dinner companions and share a gastronomic gene pool with those disposed toward mass murder and violence. And quite possibly fat.
Bloetry 1
Bloetry? Who, What, Where, Why, When is that?
Let me explain: Bloetry is my personal word for Blog Poetry. There's a lot of it around, ranging from the bloody brilliant to the bleeding awful.
I'm going to make a collection of it on this site. To kick off, let's look at the King of Bloetry - the Doggerel Pundit. The Doggerel Pundit hails from the right-wing of the blogosphere, and the site is updated frequently. The Bloetry is topical and witty, although sometimes it steals ideas from classic poems/songs (Gilbert and Sullivan, Rodgers and Hammerstein, The Beatles) - but it always adds a distinctive twist to the originals.
My personal favourite has to be the 'Tone Poem for Peace' posted during the build-up to war last year. It's especially noteworthy, since the style (rhymeless/ free-verse) is favoured more by the anti-war protesters than the pro-war dissenters.
Hey Sheen, remember the last time you stubbed your toe? Hurt like sin didn't it? See it Martin. Feel it. A single Iraqi voice can be louder than an entire anti-war protest. Hear the real people Martin. Hear them forever.
A Tone Poem For Peace
zzzrzrzrzrzrzrzrzrRZRZRRRRRRRRRRRRRRRRRRRRRRRR……..
Give peace a chance!
(ZRZRRRRRRRRR. Achmed - "Aghhh…no….NO!…FOR THE LOVE OF GOD Nooooo…ANNNHHHH"…ZRGRSchchchGNCHSchchch)
Violence never solved anything!
(ZRZRRRRRRRRR. Adnan - "Aghhh…no….NO!…FOR THE LOVE OF GOD Nooooo…ANNNHHHH"…ZRGRSchchchGNCHSchchch)
No rush to war!
(ZRZRRRRRRRRR. Hamid - "Aghhh…no….NO!…FOR THE LOVE OF GOD Nooooo…ANNNHHHH"…ZRGRSchchchGNCHSchchch)
No blood for oil!
(ZRZRRRRRRRRR. Ismael - "Aghhh…no….NO!…FOR THE LOVE OF GOD Nooooo…ANNNHHHH"…ZRGRSchchchGNCHSchchch)
Give the inspectors more time!
(ZRZRRRRRRRRR. Tarik - "Aghhh…no….NO!…FOR THE LOVE OF GOD Nooooo…ANNNHHHH"…ZRGRSchchchGNCHSchchch)
Not in our name!
(ZRZRRRRRRRRR. Faisal - "Aghhh…no….NO!…FOR THE LOVE OF GOD Nooooo…ANNNHHHH"…ZRGRSchchchGNCHSchchch)
The 48 hours are up and cruise missiles have begun hitting government targets in Baghdad.
(ZRZRzrzrzrzrzrzrzrrrrrrrr…rr…rr…rr……r…...)
Any questions?
Jim Treacher, Right-wing ratbag, published on Poets against the War, using another of the favourite tricks of anti-war artists - culture jamming. Try and figure out for yourself how he managed to sneak in a pro-war message into this little lyric:
Stop it, Mr. Bush.
Taking lives is going to help?
Unilateral murder of thousands?
Preposterous!
Is it easy to sleep at night, Mr. Bush?
Do you care?
How does it feel to kill babies, Mr. Bush?
Innocent little babies?
Presidents shouldn't do that, but then, you wouldn't know.
Pause and reflect, Mr. Bush.
If you continue on this course,
Elections aren't the only things you'll steal.
Freedom fries aren't the issue, Mr. Bush.
All your bombs can't blow up the truth.
George W. Bush, wake up!
Smell the crying children.
It's a cheap, puerile, offensive trick to pull - and let's all hope Treacher continues to be cheap, puerile and offensive for years and years!
More poetry to blog ... but not enough space, or time. Later!
Let me explain: Bloetry is my personal word for Blog Poetry. There's a lot of it around, ranging from the bloody brilliant to the bleeding awful.
I'm going to make a collection of it on this site. To kick off, let's look at the King of Bloetry - the Doggerel Pundit. The Doggerel Pundit hails from the right-wing of the blogosphere, and the site is updated frequently. The Bloetry is topical and witty, although sometimes it steals ideas from classic poems/songs (Gilbert and Sullivan, Rodgers and Hammerstein, The Beatles) - but it always adds a distinctive twist to the originals.
My personal favourite has to be the 'Tone Poem for Peace' posted during the build-up to war last year. It's especially noteworthy, since the style (rhymeless/ free-verse) is favoured more by the anti-war protesters than the pro-war dissenters.
Hey Sheen, remember the last time you stubbed your toe? Hurt like sin didn't it? See it Martin. Feel it. A single Iraqi voice can be louder than an entire anti-war protest. Hear the real people Martin. Hear them forever.
A Tone Poem For Peace
zzzrzrzrzrzrzrzrzrRZRZRRRRRRRRRRRRRRRRRRRRRRRR……..
Give peace a chance!
(ZRZRRRRRRRRR. Achmed - "Aghhh…no….NO!…FOR THE LOVE OF GOD Nooooo…ANNNHHHH"…ZRGRSchchchGNCHSchchch)
Violence never solved anything!
(ZRZRRRRRRRRR. Adnan - "Aghhh…no….NO!…FOR THE LOVE OF GOD Nooooo…ANNNHHHH"…ZRGRSchchchGNCHSchchch)
No rush to war!
(ZRZRRRRRRRRR. Hamid - "Aghhh…no….NO!…FOR THE LOVE OF GOD Nooooo…ANNNHHHH"…ZRGRSchchchGNCHSchchch)
No blood for oil!
(ZRZRRRRRRRRR. Ismael - "Aghhh…no….NO!…FOR THE LOVE OF GOD Nooooo…ANNNHHHH"…ZRGRSchchchGNCHSchchch)
Give the inspectors more time!
(ZRZRRRRRRRRR. Tarik - "Aghhh…no….NO!…FOR THE LOVE OF GOD Nooooo…ANNNHHHH"…ZRGRSchchchGNCHSchchch)
Not in our name!
(ZRZRRRRRRRRR. Faisal - "Aghhh…no….NO!…FOR THE LOVE OF GOD Nooooo…ANNNHHHH"…ZRGRSchchchGNCHSchchch)
The 48 hours are up and cruise missiles have begun hitting government targets in Baghdad.
(ZRZRzrzrzrzrzrzrzrrrrrrrr…rr…rr…rr……r…...)
Any questions?
Jim Treacher, Right-wing ratbag, published on Poets against the War, using another of the favourite tricks of anti-war artists - culture jamming. Try and figure out for yourself how he managed to sneak in a pro-war message into this little lyric:
Stop it, Mr. Bush.
Taking lives is going to help?
Unilateral murder of thousands?
Preposterous!
Is it easy to sleep at night, Mr. Bush?
Do you care?
How does it feel to kill babies, Mr. Bush?
Innocent little babies?
Presidents shouldn't do that, but then, you wouldn't know.
Pause and reflect, Mr. Bush.
If you continue on this course,
Elections aren't the only things you'll steal.
Freedom fries aren't the issue, Mr. Bush.
All your bombs can't blow up the truth.
George W. Bush, wake up!
Smell the crying children.
It's a cheap, puerile, offensive trick to pull - and let's all hope Treacher continues to be cheap, puerile and offensive for years and years!
More poetry to blog ... but not enough space, or time. Later!
Sunday, April 11, 2004
More Easter stuff
Ah, Easter, the Festival of Chocolate... delicious, delectable chocolate...
(Oh yeah - and all that stuff about Jesus dying on the cross, yada yada yada - I suppose I should mention that too)
Now. Where was I?
(Oh yeah - and all that stuff about Jesus dying on the cross, yada yada yada - I suppose I should mention that too)
Now. Where was I?
Speaking of Which
Thou Shalt Read The Winners in Ship of Fools 11th Commandment Competition.
(Even if thou shalt be left with the lingering suspicion that thou could have done much better than some of the winners...)
Thou shalt not worship false pop idols
Thou shalt not kill in the name of any god
Thou shalt not be negative
(Even if thou shalt be left with the lingering suspicion that thou could have done much better than some of the winners...)
Thou shalt not worship false pop idols
Thou shalt not kill in the name of any god
Thou shalt not be negative
Since it's Easter, let's take a look at some Christian websites
The Wibsite has published a list of (amongst other things) the Best Christian Humour website. The winner - the funny but infrequently updated Ship of Fools.
Saturday, April 10, 2004
Bitter and Twisted
Of all the old curmedgeons working in Australian journalism today, one of the curmudgleonist has to be Alan Ramsey. He works for the Sydney Morning Herald, turning out mediocre 1000-words-plus copy every Saturday and Wednesday. I say 'works', not 'writes', because Ramsey hardly writes anything anymore - his opinions are all recycled, regurgitated remnants of speeches, articles, columns, written by others, or indeed, writings of an earlier, marginally less cynical Ramsey of the 80s and 90s, one who may or may not have possessed a modicum of wit, originality, and intelligence.
His column today fits this description perfectly - after a cursory introduction (along the lines of 'Latham = Good; Bush/Howard = Bad'), he lifts a few paragraphs from a speech made by Ted Kennedy, and plonks it down to fill the bulk of his article. And that's it, really. Oh, there are several paragraphs to come, more white paper to fill - so he duly fills it up with standard journalistic cliches about 'the policy excesses and mendacity of the White House', and 'the national self-respect of a more independent foreign policy attitude that does not take its lead from our Prime Minister forever on hands and knees to Washington'; he lifts a paragraph or two from a Maureen Dowd column, and concludes.
I read columns for insight, originality, to be informed, entertained, and challenged, and this is exactly the reason why I don't read Ramsey anymore. What he gives is not insight or originality, but recycled insight and originality; he takes the ideas of others and appends his own name to it. It's a cynical exercise, but he gets away with it - perhaps because journalism is cynicism under another name.
But the strange thing is, even his cynicism is not real. In reality, what we get from Ramsey are the twisted ramblings of an old fart doing his best to live up to our expectations of him as an old fart. It's one of the reasons why I stopped buying the Herald half-a-year ago - maybe he wants to keep getting paid for the exercise, but I don't want to be the one paying him for it.
UPDATE - Tim Blair has posted more on Ramsey's Saturday morning piece.
His column today fits this description perfectly - after a cursory introduction (along the lines of 'Latham = Good; Bush/Howard = Bad'), he lifts a few paragraphs from a speech made by Ted Kennedy, and plonks it down to fill the bulk of his article. And that's it, really. Oh, there are several paragraphs to come, more white paper to fill - so he duly fills it up with standard journalistic cliches about 'the policy excesses and mendacity of the White House', and 'the national self-respect of a more independent foreign policy attitude that does not take its lead from our Prime Minister forever on hands and knees to Washington'; he lifts a paragraph or two from a Maureen Dowd column, and concludes.
I read columns for insight, originality, to be informed, entertained, and challenged, and this is exactly the reason why I don't read Ramsey anymore. What he gives is not insight or originality, but recycled insight and originality; he takes the ideas of others and appends his own name to it. It's a cynical exercise, but he gets away with it - perhaps because journalism is cynicism under another name.
But the strange thing is, even his cynicism is not real. In reality, what we get from Ramsey are the twisted ramblings of an old fart doing his best to live up to our expectations of him as an old fart. It's one of the reasons why I stopped buying the Herald half-a-year ago - maybe he wants to keep getting paid for the exercise, but I don't want to be the one paying him for it.
UPDATE - Tim Blair has posted more on Ramsey's Saturday morning piece.
Friday, April 09, 2004
Horror!!!
Oh what a horrible morning,
Oh what a horrible day,
Oh what a horrible morning,
They're married, they're men and they're gay!
I was, until five minutes ago, quite tolerant about the issue of gay marriage. But I've just read Andrew Sullivan, explaining the hidden gay agenda:
Actually, you won't only lose your job, you'll be forced to sing show-tunes every Sunday.
Oh what a horrible day,
Oh what a horrible morning,
They're married, they're men and they're gay!
I was, until five minutes ago, quite tolerant about the issue of gay marriage. But I've just read Andrew Sullivan, explaining the hidden gay agenda:
Actually, you won't only lose your job, you'll be forced to sing show-tunes every Sunday.
Frankly Gay
"I'm not giggling," I said, baritonely. "I'm guffawing." I passed up the news magazine containing photographs of gay couples getting married in San Francisco.
Frank Devine in The Australian. There's more:
Openly different at last, gays might have been expected to contribute more of the originality, style and, yes, gaiety that is within their gift as viewers of society through a special prism. The grip of numerous ill-based certainties has been loosened by mordant gay scrutiny.
That's Devine on the gaiety of gays. Here's Devine on ... well, matters divine:
If I were to go to St Mary's Cathedral, kneel with hand outstretched, look Cardinal George Pell in the eye and say "F--- you" in a loud voice, I would become a comic legend. So let it be with gays who harass innocent bishops and priests at the communion rail, wearing gear that utters the same derisive challenge.
There's more still, and all funny and insightful. Go read...
Frank Devine in The Australian. There's more:
Openly different at last, gays might have been expected to contribute more of the originality, style and, yes, gaiety that is within their gift as viewers of society through a special prism. The grip of numerous ill-based certainties has been loosened by mordant gay scrutiny.
That's Devine on the gaiety of gays. Here's Devine on ... well, matters divine:
If I were to go to St Mary's Cathedral, kneel with hand outstretched, look Cardinal George Pell in the eye and say "F--- you" in a loud voice, I would become a comic legend. So let it be with gays who harass innocent bishops and priests at the communion rail, wearing gear that utters the same derisive challenge.
There's more still, and all funny and insightful. Go read...
Author Unknown
Great characterisations, sparkling dialogue, and a ripper of a plot... yep, it's Chromosome Number One, courtesy of it's editor (the Human Genome Project). Over at Project Gutenberg. An excerpt:
... GGCTCTTTATATGGTGAGTGGCAACTGGTTTTGGACCTCTCTCTTGCAGG
CTGGGTCTGTGGGATGTAATTAGAAAGCAACTTTATTTCTATTCACTTAC
ATTTATTCATTGGAGGAGGAGTTTCTCTTTCCTAGGGTACACGTGGACAT
GCCTATGACTTTTCTGCTTTGTCTTATGTTTAAAAATGTCCTTCAGTCAT
TGCAGGTCACAAGCAGGCTATCAGCTCAGTAATTAAAATAATTCGGTTCT
TCATAGTGAATGTAATTCTAAATTAGATTTTAAGTTGTAACTCCCTGCTT...
Hey, I think I see a spelling mistake!!.... anybody got a dictionary??...
(Via the UnAustralian)
... GGCTCTTTATATGGTGAGTGGCAACTGGTTTTGGACCTCTCTCTTGCAGG
CTGGGTCTGTGGGATGTAATTAGAAAGCAACTTTATTTCTATTCACTTAC
ATTTATTCATTGGAGGAGGAGTTTCTCTTTCCTAGGGTACACGTGGACAT
GCCTATGACTTTTCTGCTTTGTCTTATGTTTAAAAATGTCCTTCAGTCAT
TGCAGGTCACAAGCAGGCTATCAGCTCAGTAATTAAAATAATTCGGTTCT
TCATAGTGAATGTAATTCTAAATTAGATTTTAAGTTGTAACTCCCTGCTT...
Hey, I think I see a spelling mistake!!.... anybody got a dictionary??...
(Via the UnAustralian)
Thursday, April 08, 2004
Back Go Way Wrong
I'm not wrong, everybody else is.
A pensioner spotted driving the wrong way down a motorway stopped when he saw police, to complain that everyone else was heading in the wrong direction.
A pensioner spotted driving the wrong way down a motorway stopped when he saw police, to complain that everyone else was heading in the wrong direction.
Wednesday, April 07, 2004
Economics You Can Understand
Back to Hackademia
Emma Tom goes to Uni, and finds herself reading some rather uncomprehensible postmodernism:
While I understood most of the individual words in isolation, the way they'd been arranged in relation to each other rendered them completely incomprehensible.
"If, in other words, the global is the site of the homogeneous (or the common) and the local the site of the diverse and the distinctive, then the latter can – in today's integrated world systems – only constitute and reconstitute itself in and through concrete reworkings and appropriations of the former."
Um. About half past three?
She goes on to quote Lloyd Evans from The Spectator: "It's like tlfdtjdtx in the middle of this sentence."
Come on, Ms. Tom - anybody would know that the accepted Australian English spelling is 'tlfdtjdtyx'.
While I understood most of the individual words in isolation, the way they'd been arranged in relation to each other rendered them completely incomprehensible.
"If, in other words, the global is the site of the homogeneous (or the common) and the local the site of the diverse and the distinctive, then the latter can – in today's integrated world systems – only constitute and reconstitute itself in and through concrete reworkings and appropriations of the former."
Um. About half past three?
She goes on to quote Lloyd Evans from The Spectator: "It's like tlfdtjdtx in the middle of this sentence."
Come on, Ms. Tom - anybody would know that the accepted Australian English spelling is 'tlfdtjdtyx'.
Sunday, April 04, 2004
Treacher Back
Youth Yartz
I was at the opening of this on Friday - Art Xpress, an exhibition of artworks by HSC students. In 2003 and 2002 I was also able to make it along to the Art Xpress exhibitions, and in my own opinion, they're the definitely the best shows on offer at the Newcastle Regional Art Gallery.
If you're in Newcastle in the next month or so, come and have a look!
If you're in Newcastle in the next month or so, come and have a look!
How About That?
A blogworthy topic: today is the 4th of the 4th of the 4th.
In a few hours time, it will be 4:44 pm of the 4th of the 4th of the 4th.
That is all.
In a few hours time, it will be 4:44 pm of the 4th of the 4th of the 4th.
That is all.
Friday, April 02, 2004
Kwote Unkwote
The Australian newspaper regularly publishes snippets of news, opinion, and humour from other newspapers and magazines around the world. Actually, in their weekend edition, they have a whole section devoted to it.
I like this idea - it's kinda nice to know that for the price of a broadsheet, you get access to some of the top publications the world over.
But funny things happen. Today, on their website, they quote from this article by James Kurth (originally published in The American Conservative) which argues that democracy in Iraq won't work.
I've pasted the full text below. Scroll down a bit until you get to this paragraph:
IS the Bush project - the seeding of genuine liberty in a region that's never known it - going to work? Well, we know for certain that the old realpolitik approach to the Middle East doesn't work: that's what gave us September 11.
This is a weird kind of argument to be making if you believe that democracy isn't going to work in Iraq. But then, Kurth didn't make it - take a look at the article in the American Conservative, and you won't find those paragraphs. In fact, the text was lifted straight out of a Mark Steyn article, published in The Spectator and The Scotsman.
There are usually a few mistakes on the website every day. I won't have time to check The Australian until later today; but it'll be interesting to see if the same mistake was made in their paper. I'll get back to you when I find out more...
Scrapbook: Will democracy work in Iraq?
April 02, 2004
No, says James Kurth, in The American Conservative
THE US effort to bring democracy to Iraq will end in failure. That effort may fail because the Iraqi people do not have the cultural values, social conditions or historical experience with which to construct a democracy. Or it may fail because the Iraqi people come to associate democracy with the US occupation and with all the disruptions and humiliations that a military administration inevitably brings.
Or it may fail because there is actually no Iraqi people at all, only three peoples who will use democracy to break away from each other - at best, this would result in three democracies, rather than one; at worst, it would result in three states engaged in a new war of their very own. Or it may fail because of all of the above.
With all these paths leading straight to failure, it will take a miracle for the US democratisation project in Iraq to succeed. The failure of democratisation in Iraq will discredit similar US efforts elsewhere. The damage will be greatest in the Muslim world, where Islamism will be left as the only valid ideology and Islamisation as the only vital political and social project. Elsewhere, the harm will not be as profound, but for a few years at least, other countries will dismiss any US promotions of democratisation as just another preposterous, feckless and tiresome US conceit.
The US might be able to absorb and eventually recover from this failure in Iraq, rather like it absorbed and eventually recovered from its epic failure in Vietnam three decades ago. Indeed, 30 years from now, Islamism might itself be discredited in the Middle East, rather like communism is discredited in South-East Asia today. But like that earlier war, at the end of the day virtually all honest and reasonable people will agree that it would have been best if the US had never gone to war at all.
IS the Bush project - the seeding of genuine liberty in a region that's never known it - going to work? Well, we know for certain that the old realpolitik approach to the Middle East doesn't work: that's what gave us September 11. The theory some of us have advanced for 2 1/2 years now is that the region's stability - the stability of a petrified septic tank - is the problem, and that any upturning of that stability would be hard put to make things worse.
But it isn't a theory any longer. Instead of just rushing in and holding a national election, the Americans went in with a Tocquevillian plan to build representative government from the ground up. As Andrew Natsios of the US Agency for International Development says: "Local government is the schoolhouse of democracy." Iraq's new town councils are up and running and covering 90 per cent of the population. When you're building a state, that local foundation matters more than the federal government, the final brick in the pyramid. This is a complete inversion of the way the British did things when they invented Iraq: they started by importing a king from the Hashemites and worked down. But, given the way that turned out, the US method could hardly be less successful ...
The dominoes have all begun teetering in the right direction. Even the most gung-ho Iranian theocrat doesn't expect the mullahs to be running the joint in 10 years' time, or even five. In Syria, Boy Assad thought he could have fun destabilising the new Iraq. Instead, it's destabilising him. For the first time in years, there are serious protests against what is now the sole surviving Baath party. There will be movement in both Iran and Syria before the end of the year.
UPDATE - Steyn gets an acknowledgement in the hard copy of the paper, but the error remains uncorrected on the website.
I like this idea - it's kinda nice to know that for the price of a broadsheet, you get access to some of the top publications the world over.
But funny things happen. Today, on their website, they quote from this article by James Kurth (originally published in The American Conservative) which argues that democracy in Iraq won't work.
I've pasted the full text below. Scroll down a bit until you get to this paragraph:
IS the Bush project - the seeding of genuine liberty in a region that's never known it - going to work? Well, we know for certain that the old realpolitik approach to the Middle East doesn't work: that's what gave us September 11.
This is a weird kind of argument to be making if you believe that democracy isn't going to work in Iraq. But then, Kurth didn't make it - take a look at the article in the American Conservative, and you won't find those paragraphs. In fact, the text was lifted straight out of a Mark Steyn article, published in The Spectator and The Scotsman.
There are usually a few mistakes on the website every day. I won't have time to check The Australian until later today; but it'll be interesting to see if the same mistake was made in their paper. I'll get back to you when I find out more...
Scrapbook: Will democracy work in Iraq?
April 02, 2004
No, says James Kurth, in The American Conservative
THE US effort to bring democracy to Iraq will end in failure. That effort may fail because the Iraqi people do not have the cultural values, social conditions or historical experience with which to construct a democracy. Or it may fail because the Iraqi people come to associate democracy with the US occupation and with all the disruptions and humiliations that a military administration inevitably brings.
Or it may fail because there is actually no Iraqi people at all, only three peoples who will use democracy to break away from each other - at best, this would result in three democracies, rather than one; at worst, it would result in three states engaged in a new war of their very own. Or it may fail because of all of the above.
With all these paths leading straight to failure, it will take a miracle for the US democratisation project in Iraq to succeed. The failure of democratisation in Iraq will discredit similar US efforts elsewhere. The damage will be greatest in the Muslim world, where Islamism will be left as the only valid ideology and Islamisation as the only vital political and social project. Elsewhere, the harm will not be as profound, but for a few years at least, other countries will dismiss any US promotions of democratisation as just another preposterous, feckless and tiresome US conceit.
The US might be able to absorb and eventually recover from this failure in Iraq, rather like it absorbed and eventually recovered from its epic failure in Vietnam three decades ago. Indeed, 30 years from now, Islamism might itself be discredited in the Middle East, rather like communism is discredited in South-East Asia today. But like that earlier war, at the end of the day virtually all honest and reasonable people will agree that it would have been best if the US had never gone to war at all.
IS the Bush project - the seeding of genuine liberty in a region that's never known it - going to work? Well, we know for certain that the old realpolitik approach to the Middle East doesn't work: that's what gave us September 11. The theory some of us have advanced for 2 1/2 years now is that the region's stability - the stability of a petrified septic tank - is the problem, and that any upturning of that stability would be hard put to make things worse.
But it isn't a theory any longer. Instead of just rushing in and holding a national election, the Americans went in with a Tocquevillian plan to build representative government from the ground up. As Andrew Natsios of the US Agency for International Development says: "Local government is the schoolhouse of democracy." Iraq's new town councils are up and running and covering 90 per cent of the population. When you're building a state, that local foundation matters more than the federal government, the final brick in the pyramid. This is a complete inversion of the way the British did things when they invented Iraq: they started by importing a king from the Hashemites and worked down. But, given the way that turned out, the US method could hardly be less successful ...
The dominoes have all begun teetering in the right direction. Even the most gung-ho Iranian theocrat doesn't expect the mullahs to be running the joint in 10 years' time, or even five. In Syria, Boy Assad thought he could have fun destabilising the new Iraq. Instead, it's destabilising him. For the first time in years, there are serious protests against what is now the sole surviving Baath party. There will be movement in both Iran and Syria before the end of the year.
UPDATE - Steyn gets an acknowledgement in the hard copy of the paper, but the error remains uncorrected on the website.
Thursday, April 01, 2004
I Am In Denial
Jim Treacher has not quit. He's still blogging. This is all just an April Fool's joke, right, Jim? Right? Jim? SPEAKTOMEGODDAMMIT!!!
How Are the Mighty Fallen
A Multiplicity of Mammaries
A woman in central China who paid for breast enlargement surgery ended up with an unwanted bonus - two extra breasts.
Read the whole story in The SMH.
Read the whole story in The SMH.
Dangerous World
The Passion of the Christ has already cruelly killed one pastor, while the death toll for The Lord of the Rings continues to rise.
And just now on the ABC, I've seen a story about killer goalposts. Seems kids playing soccer are in mortal peril of the soccer goalposts - well - falling on them.
And just now on the ABC, I've seen a story about killer goalposts. Seems kids playing soccer are in mortal peril of the soccer goalposts - well - falling on them.
