tag:blogger.com,1999:blog-63466732011-04-22T12:08:03.649+10:00Caution: this page may contain traces of nuts...TimThttp://www.blogger.com/profile/10333303180015967125noreply@blogger.comBlogger991100tag:blogger.com,1999:blog-6346673.post-1088945348336782602004-07-04T22:45:00.000+10:002004-07-04T22:50:06.176+10:00

Right, this is just to point out that I've started a new blog. It's address is: http://www.willtypeforfood.blogspot.com As you can see from reading the blog, it's basically a way of reaching employers or people who might know employers. Not to mention an excuse to have a whinge about my usual obsessions, without feeling entirely guilty about not looking for jobs 25 hours a day, 8 days a

TimThttp://www.blogger.com/profile/10333303180015967125noreply@blogger.comtag:blogger.com,1999:blog-6346673.post-1086422439448276852004-06-05T17:45:00.000+10:002004-06-05T18:00:39.446+10:00

Hello. Me again. Not hanging about for long - this is still to all intents and purposes an 'ex-blog.' But just had to post this: I HAVE FEEDBACK! A month or so after closing this blog down, I've got a wonderful tirade, courtesy of Scott Hillard, who I blogged about some time ago. If you want to get the context, re-read that original post, then come back here to enjoy Scott's response, in all

TimThttp://www.blogger.com/profile/10333303180015967125noreply@blogger.comtag:blogger.com,1999:blog-6346673.post-1083628252021082062004-05-04T09:32:00.000+10:002004-05-04T09:54:58.826+10:00

Here's a list of classic books posted by Scott Wickstein and Tex; you highlight the ones you've read. So... 1984, George Orwell Depressing. The Alchemist, Paulo Coelho Alice's Adventures In Wonderland, Lewis Carroll Animal Farm, George Orwell Anna Karenina, Leo Tolstoy Anne Of Green Gables, LM Montgomery Artemis Fowl, Eoin Colfer The BFG, Roald Dahl Birdsong, Sebastian Faulks Black Beauty, Anna

TimThttp://www.blogger.com/profile/10333303180015967125noreply@blogger.comtag:blogger.com,1999:blog-6346673.post-1083547393861881962004-05-03T11:17:00.000+10:002004-05-03T11:27:35.653+10:00

A barely significant minority wins an unimportantly low proportion of the vote in an obscure Tasmanian electorate. The Green Left Weakly is mighty chuffed: Socialist Alliance tops 5%! HOBART — With 78% of the vote counted by the end of polling night on May 1, Socialist Alliance candidate Kamala Emanuel had received 860 votes or 5.27% in the Tasmanian upper house seat of Elwick. Greens

TimThttp://www.blogger.com/profile/10333303180015967125noreply@blogger.comtag:blogger.com,1999:blog-6346673.post-1083241091021492932004-04-29T22:17:00.000+10:002004-04-29T22:22:27.920+10:00

Paul and Carl: asking the tough questions.

TimThttp://www.blogger.com/profile/10333303180015967125noreply@blogger.comtag:blogger.com,1999:blog-6346673.post-1083239936956535772004-04-29T21:56:00.000+10:002004-04-29T22:21:11.123+10:00

... Achewood has all your romance needs covered.

TimThttp://www.blogger.com/profile/10333303180015967125noreply@blogger.comtag:blogger.com,1999:blog-6346673.post-1083238886051193732004-04-29T21:34:00.000+10:002004-04-29T21:45:42.606+10:00

Apparently God has been subtly rigging the polls at Port Stephens to get the desired results: West Ward Councillor Sally Dover told the new Port Stephens Council at its first meeting whether they believed it or not, they had been appointed by God. Scandalous! Shocking! Stupefying! (etc etc) This God person must be stopped immediately before he destroys the foundations of our democracy! (

TimThttp://www.blogger.com/profile/10333303180015967125noreply@blogger.comtag:blogger.com,1999:blog-6346673.post-1083124238670976842004-04-28T13:42:00.000+10:002004-04-28T13:55:05.153+10:00

According to a story picked up by Al-Hayat, members of Al-Qaeda working for Al-Zarqawi have been found in Jordan with WMD that probably came from Jordan that may have come from Iraq that may have been the very Weapons of Mass Destruction that George Bush was looking for. Anyway, it's all very important. Read story here. Uh... would someone please massage my brain?

TimThttp://www.blogger.com/profile/10333303180015967125noreply@blogger.comtag:blogger.com,1999:blog-6346673.post-1083118959520193182004-04-28T12:08:00.000+10:002004-04-28T12:26:54.420+10:00

Washington, Tuesday - in a move that has shocked nobody, President of the USA, George Bush, has announced: "I was wrong and the hippies were right. I should never have invaded Iraq. I should have realised, what the Iraqi people need is love, not war. War has never solved anything." When questioned by journalists what caused this sudden turn-around in policy, Mr. Bush said, "It had to happen

TimThttp://www.blogger.com/profile/10333303180015967125noreply@blogger.comtag:blogger.com,1999:blog-6346673.post-1083117645280738302004-04-28T11:51:00.000+10:002004-04-28T12:05:00.450+10:00

You've had word of the day, quote of the day, man of the day, and time of the day - so why not day of the day? Novocastria is pleased to announce that the day of the day today is: Wednesday! It's just 24 hours after Tuesday, and 24 hours before Thursday. It's wedged neatly in the middle of the week, a median day, a not-quite day, a day that's unsure whether it's beginning or ending, but

TimThttp://www.blogger.com/profile/10333303180015967125noreply@blogger.comtag:blogger.com,1999:blog-6346673.post-1083116862674063212004-04-28T11:28:00.000+10:002004-04-28T11:53:33.186+10:00

Harry Hutton at Chase Me Ladies records an incomprehensible conversation with a student: "How to say [in English] trouser," he asked, "but isn't trouser?" "Huh?" I said. "Isn't trouser. What it is?" I had a similar experience yesterday. Matt, a young kid I know, asks me: "If I was 22, what year would it be?" "2004", I reply. "No!" he shoots back. "I mean, how old would I be?" "22", I

TimThttp://www.blogger.com/profile/10333303180015967125noreply@blogger.comtag:blogger.com,1999:blog-6346673.post-1083115370488530872004-04-28T11:09:00.000+10:002004-04-28T11:27:05.326+10:00

Fake humanitarian Fidel Castro must be feeling real stupid after holding a real 25-minute phone conversation with a fake Hugo Chavez: Two Miami radio journalists were fined $5,463 dollars for broadcasting a phone conversation that fooled Cuban President Fidel Castro into believing he was talking with Venezuelan President Hugo Chavez. Joe Ferrero and Enrique Santos, of Spanish-language radio

TimThttp://www.blogger.com/profile/10333303180015967125noreply@blogger.comtag:blogger.com,1999:blog-6346673.post-1083114456783444742004-04-28T10:59:00.000+10:002004-04-28T11:12:48.013+10:00

I'm a turkey girl In a turkey wo -o-orld, Made of plastic, It's fantastic...

TimThttp://www.blogger.com/profile/10333303180015967125noreply@blogger.comtag:blogger.com,1999:blog-6346673.post-1082964132721515782004-04-26T16:17:00.000+10:002004-04-26T17:30:23.750+10:00

Do great magazines die, or do they just go on and on? Tim Blair links to Mark Steyn and Denis Boyles, who both claim to see a decline in the quality of journalism over at The Spectator, the mouthpiece for Conservative Britain. His readers seem to agree. Of course, they have in mind the most recent issue, which published articles by Andrew Gilligan, Sam Kiley and Rod Liddle, all strongly

TimThttp://www.blogger.com/profile/10333303180015967125noreply@blogger.comtag:blogger.com,1999:blog-6346673.post-1082945001369069702004-04-26T11:53:00.000+10:002004-04-26T17:32:35.090+10:00

Tim Blair alerts us to an entertaining new blog, Chase Me Ladies! It's only a week old, but it's already clocked up an impressive list of bad puns, entertaining stories, killer facts, meditations on the state of the statuary in London, and several innovative dating techniques. I think I'll be following this blog regularly.

TimThttp://www.blogger.com/profile/10333303180015967125noreply@blogger.comtag:blogger.com,1999:blog-6346673.post-1082867251949256852004-04-25T14:21:00.000+10:002004-04-25T14:32:24.233+10:00

Paul and Carl have an exciting scoop on the new series of Big Brother about to go to air. Click here for the details! They also get the dirt on a frightening group of terrorists - the notorious Al-gebra movement. Why go to a respectable news source when you can get your daily dose of lies for free at P&C's Daily Diatribe?

TimThttp://www.blogger.com/profile/10333303180015967125noreply@blogger.comtag:blogger.com,1999:blog-6346673.post-1082866881291522872004-04-25T14:16:00.000+10:002004-04-25T14:25:32.200+10:00

... or at least that's what this link on msn suggests. "Win a girl's night out with Brad Pitt". In other news, I spotted an advertisement from the Sydney Symphony Orchestra in yesterday's Australian; seems they're looking for a publisist! Yep! You heard me right! I wonder if they meant it?

TimThttp://www.blogger.com/profile/10333303180015967125noreply@blogger.comtag:blogger.com,1999:blog-6346673.post-1082358253196880972004-04-19T17:01:00.000+10:002004-04-19T17:08:16.246+10:00

Tim Dunlop writes: I did actually write a long post yesterday but I somehow banished it to electronic oblivion and despite lengthy attempts to retrieve it, I failed miserably. It's a shame too because it was probably the best post I've ever written and may well have been the best post anyone has ever written. It captured my thinking on a number of topics and expressed it in the sort of

TimThttp://www.blogger.com/profile/10333303180015967125noreply@blogger.comtag:blogger.com,1999:blog-6346673.post-1082250645902147502004-04-18T10:58:00.000+10:002004-04-18T11:14:47.140+10:00

Let's take a look at this little article by Peter Singer about bonking beasts.... At a conference on great apes a few years ago, I spoke to a woman who had visited Camp Leakey, a rehabilitation center for captured orangutans in Borneo run by Birute Galdikas, sometimes referred to as "the Jane Goodall of orangutans" and the world's foremost authority on these great apes. At Camp Leakey, the

TimThttp://www.blogger.com/profile/10333303180015967125noreply@blogger.comtag:blogger.com,1999:blog-6346673.post-1082202520461062882004-04-17T21:30:00.000+10:002004-04-18T09:43:28.496+10:00

Some Updates from the World of Blog. The Rat Pack have a caption competition underway; head on over and make a caption of your own. Joy likes knitting; her third post inspires a fascinating comments thread over at Tim Blair's blog. Staying over at Blair's Blog, we find Tim looking at a piece on Professor Singer about George Bush that ... well, this is what it says: "Professor Singer said Mr

TimThttp://www.blogger.com/profile/10333303180015967125noreply@blogger.comtag:blogger.com,1999:blog-6346673.post-1082170711626265882004-04-17T12:51:00.000+10:002004-04-17T13:02:30.936+10:00

Tim Blair is on a roll. Read his excellent dissection of Donna Mulhearn's account of being taken 'hostage', and then this post, where he catches Margo Kingston out. I wonder if the ABC's Media Watch will pick up on these?

TimThttp://www.blogger.com/profile/10333303180015967125noreply@blogger.comtag:blogger.com,1999:blog-6346673.post-1082034842285817822004-04-15T22:45:00.000+10:002004-04-15T23:18:00.093+10:00

From Tim Blair comes the news that PM John Howard has announced the end of ATSIC. Branding the experiment in elected representation for indigenous people a "failure", Mr Howard said the Aboriginal and Torres Strait Islander Commission would be abolished within months and not replaced. But Labor got there first. March 30, 2004 - 4:47PM Opposition leader Mark Latham said today a Labor

TimThttp://www.blogger.com/profile/10333303180015967125noreply@blogger.comtag:blogger.com,1999:blog-6346673.post-1081814409123038352004-04-13T09:49:00.000+10:002004-04-13T10:37:27.123+10:00

Charles Austin, proprietor of the blog Sine Qua Non, blows us away with the following bloem, full of juicy, linky goodness: Nibblin' on cheesesteak, With Swiss for Pete's sake, Protestors screaming, "No blood for oil." Strummin' my six string, On my own jet, schwing! Mental shrimps, they're beginning to spoil. Wasted away again listening to James Carville, Searching for my lost sense of

TimThttp://www.blogger.com/profile/10333303180015967125noreply@blogger.comtag:blogger.com,1999:blog-6346673.post-1081755777617569962004-04-12T17:38:00.000+10:002004-04-12T17:49:27.403+10:00

BOLT: I'm talking to you as probably our most influential Muslim educator. And you're speaking to someone widely regarded by Muslim spokesmen as . . . SALMAN: A Muslim basher. The opening of an interview between Andrew Bolt and Dr. Salah Salman, head of the King Khalid Islamic college. "We parted all smiles," writes Bolt, "although I doubt I reassured Salman much. Him I found charming,

TimThttp://www.blogger.com/profile/10333303180015967125noreply@blogger.comtag:blogger.com,1999:blog-6346673.post-1081754314797972362004-04-12T17:04:00.000+10:002004-04-12T17:25:00.246+10:00

Philip Adams - the left-wing loony the right loves to hate - in a longer column about Ralph Nader mentions this interesting episode: Burnet, one of Australia’s greatest scientists, was arguing with Gorton who, slightly pissed, was talking about his plans (fortunately unrealised) for Australia to "go nuclear" in power generation. The Nobel Laureate rattled off objection after objection.

TimThttp://www.blogger.com/profile/10333303180015967125noreply@blogger.comtag:blogger.com,1999:blog-6346673.post-1081753463665902992004-04-12T16:57:00.000+10:002004-04-12T17:08:17.090+10:00

Spoken like a true meatitarian: Peter Lalor writing in The Australian today... I'VE never met a vegetarian I liked. Believe me, I've met my share and have more than an intimate knowledge of the subject having closely researched it for the best part of 15 years. The mung bean mafia are generally prone to flatulence, have poor personal hygiene, make terrible dinner companions and share a

TimThttp://www.blogger.com/profile/10333303180015967125noreply@blogger.comtag:blogger.com,1999:blog-6346673.post-1081733216198405682004-04-12T10:41:00.000+10:002004-04-12T11:30:48.983+10:00

Bloetry? Who, What, Where, Why, When is that? Let me explain: Bloetry is my personal word for Blog Poetry. There's a lot of it around, ranging from the bloody brilliant to the bleeding awful. I'm going to make a collection of it on this site. To kick off, let's look at the King of Bloetry - the Doggerel Pundit. The Doggerel Pundit hails from the right-wing of the blogosphere, and the site

TimThttp://www.blogger.com/profile/10333303180015967125noreply@blogger.comtag:blogger.com,1999:blog-6346673.post-1081668728392030642004-04-11T17:29:00.000+10:002004-04-11T17:36:00.090+10:00

Ah, Easter, the Festival of Chocolate... delicious, delectable chocolate... (Oh yeah - and all that stuff about Jesus dying on the cross, yada yada yada - I suppose I should mention that too) Now. Where was I?

TimThttp://www.blogger.com/profile/10333303180015967125noreply@blogger.comtag:blogger.com,1999:blog-6346673.post-1081667240396538882004-04-11T17:02:00.000+10:002004-04-11T17:11:12.403+10:00

Thou Shalt Read The Winners in Ship of Fools 11th Commandment Competition. (Even if thou shalt be left with the lingering suspicion that thou could have done much better than some of the winners...) Thou shalt not worship false pop idols Thou shalt not kill in the name of any god Thou shalt not be negative

TimThttp://www.blogger.com/profile/10333303180015967125noreply@blogger.comtag:blogger.com,1999:blog-6346673.post-1081666920813871902004-04-11T16:50:00.000+10:002004-04-11T17:05:52.890+10:00

The Wibsite has published a list of (amongst other things) the Best Christian Humour website. The winner - the funny but infrequently updated Ship of Fools.

TimThttp://www.blogger.com/profile/10333303180015967125noreply@blogger.comtag:blogger.com,1999:blog-6346673.post-1081556266139531842004-04-10T09:40:00.000+10:002004-04-10T20:00:14.590+10:00

Of all the old curmedgeons working in Australian journalism today, one of the curmudgleonist has to be Alan Ramsey. He works for the Sydney Morning Herald, turning out mediocre 1000-words-plus copy every Saturday and Wednesday. I say 'works', not 'writes', because Ramsey hardly writes anything anymore - his opinions are all recycled, regurgitated remnants of speeches, articles, columns, written

TimThttp://www.blogger.com/profile/10333303180015967125noreply@blogger.comtag:blogger.com,1999:blog-6346673.post-1081512524278329252004-04-09T22:02:00.000+10:002004-04-09T22:13:08.903+10:00

Oh what a horrible morning, Oh what a horrible day, Oh what a horrible morning, They're married, they're men and they're gay! I was, until five minutes ago, quite tolerant about the issue of gay marriage. But I've just read Andrew Sullivan, explaining the hidden gay agenda: Actually, you won't only lose your job, you'll be forced to sing show-tunes every Sunday.

TimThttp://www.blogger.com/profile/10333303180015967125noreply@blogger.comtag:blogger.com,1999:blog-6346673.post-1081510863739196682004-04-09T21:34:00.000+10:002004-04-09T21:44:52.796+10:00

"I'm not giggling," I said, baritonely. "I'm guffawing." I passed up the news magazine containing photographs of gay couples getting married in San Francisco. Frank Devine in The Australian. There's more: Openly different at last, gays might have been expected to contribute more of the originality, style and, yes, gaiety that is within their gift as viewers of society through a special prism

TimThttp://www.blogger.com/profile/10333303180015967125noreply@blogger.comtag:blogger.com,1999:blog-6346673.post-1081509614673605912004-04-09T21:11:00.000+10:002004-04-09T21:24:03.996+10:00

Great characterisations, sparkling dialogue, and a ripper of a plot... yep, it's Chromosome Number One, courtesy of it's editor (the Human Genome Project). Over at Project Gutenberg. An excerpt: ... GGCTCTTTATATGGTGAGTGGCAACTGGTTTTGGACCTCTCTCTTGCAGG CTGGGTCTGTGGGATGTAATTAGAAAGCAACTTTATTTCTATTCACTTAC ATTTATTCATTGGAGGAGGAGTTTCTCTTTCCTAGGGTACACGTGGACAT

TimThttp://www.blogger.com/profile/10333303180015967125noreply@blogger.comtag:blogger.com,1999:blog-6346673.post-1081424428327531392004-04-08T21:37:00.000+10:002004-04-08T21:44:16.030+10:00

I'm not wrong, everybody else is. A pensioner spotted driving the wrong way down a motorway stopped when he saw police, to complain that everyone else was heading in the wrong direction.

TimThttp://www.blogger.com/profile/10333303180015967125noreply@blogger.comtag:blogger.com,1999:blog-6346673.post-1081342909559723272004-04-07T22:58:00.000+10:002004-04-07T23:05:51.860+10:00

Potatoes, tool of the devil. Pizza, gift of the Gods.

TimThttp://www.blogger.com/profile/10333303180015967125noreply@blogger.comtag:blogger.com,1999:blog-6346673.post-1081342639382908072004-04-07T22:45:00.000+10:002004-04-07T23:09:35.250+10:00

Emma Tom goes to Uni, and finds herself reading some rather uncomprehensible postmodernism: While I understood most of the individual words in isolation, the way they'd been arranged in relation to each other rendered them completely incomprehensible. "If, in other words, the global is the site of the homogeneous (or the common) and the local the site of the diverse and the distinctive, then

TimThttp://www.blogger.com/profile/10333303180015967125noreply@blogger.comtag:blogger.com,1999:blog-6346673.post-1081042472695321822004-04-04T11:32:00.000+10:002004-04-04T11:38:56.496+10:00

Turns out that Treacher's retirement lasted exactly one April Fools Day long.

TimThttp://www.blogger.com/profile/10333303180015967125noreply@blogger.comtag:blogger.com,1999:blog-6346673.post-1081042221974125142004-04-04T11:20:00.000+10:002004-04-04T11:34:03.843+10:00

I was at the opening of this on Friday - Art Xpress, an exhibition of artworks by HSC students. In 2003 and 2002 I was also able to make it along to the Art Xpress exhibitions, and in my own opinion, they're the definitely the best shows on offer at the Newcastle Regional Art Gallery. If you're in Newcastle in the next month or so, come and have a look!

TimThttp://www.blogger.com/profile/10333303180015967125noreply@blogger.comtag:blogger.com,1999:blog-6346673.post-1081041607874680922004-04-04T11:18:00.000+10:002004-04-04T11:24:03.670+10:00

A blogworthy topic: today is the 4th of the 4th of the 4th. In a few hours time, it will be 4:44 pm of the 4th of the 4th of the 4th. That is all.

TimThttp://www.blogger.com/profile/10333303180015967125noreply@blogger.comtag:blogger.com,1999:blog-6346673.post-1080863482452264672004-04-02T09:29:00.000+10:002004-04-02T14:55:55.296+10:00

The Australian newspaper regularly publishes snippets of news, opinion, and humour from other newspapers and magazines around the world. Actually, in their weekend edition, they have a whole section devoted to it. I like this idea - it's kinda nice to know that for the price of a broadsheet, you get access to some of the top publications the world over. But funny things happen. Today, on

TimThttp://www.blogger.com/profile/10333303180015967125noreply@blogger.comtag:blogger.com,1999:blog-6346673.post-1080819986429511372004-04-01T21:45:00.000+10:002004-04-01T21:50:04.593+10:00

Jim Treacher has not quit. He's still blogging. This is all just an April Fool's joke, right, Jim? Right? Jim? SPEAKTOMEGODDAMMIT!!!

TimThttp://www.blogger.com/profile/10333303180015967125noreply@blogger.comtag:blogger.com,1999:blog-6346673.post-1080818978616170782004-04-01T21:26:00.000+10:002004-04-01T21:33:16.793+10:00

TimThttp://www.blogger.com/profile/10333303180015967125noreply@blogger.comtag:blogger.com,1999:blog-6346673.post-1080818004843286722004-04-01T21:09:00.000+10:002004-04-01T21:18:48.606+10:00

A woman in central China who paid for breast enlargement surgery ended up with an unwanted bonus - two extra breasts. Read the whole story in The SMH.

TimThttp://www.blogger.com/profile/10333303180015967125noreply@blogger.comtag:blogger.com,1999:blog-6346673.post-1080817207032625202004-04-01T20:36:00.000+10:002004-04-01T21:53:56.030+10:00

The Passion of the Christ has already cruelly killed one pastor, while the death toll for The Lord of the Rings continues to rise. And just now on the ABC, I've seen a story about killer goalposts. Seems kids playing soccer are in mortal peril of the soccer goalposts - well - falling on them.

TimThttp://www.blogger.com/profile/10333303180015967125noreply@blogger.comtag:blogger.com,1999:blog-6346673.post-1080696911237560172004-03-31T11:02:00.000+10:002004-03-31T11:41:57.110+10:00

Essay question (10 marks): A dramatic monologue is a poem or speech in which the speaker reveals as much about him or herself as the topic he or she is speaking about. Analyse the following passage from Newcastle University student magazine Opus as a dramatic monologue... Paul Wynn's article published in this edition of Opus attacked the women's handbook put out by the women's collective

TimThttp://www.blogger.com/profile/10333303180015967125noreply@blogger.comtag:blogger.com,1999:blog-6346673.post-1080694472406807812004-03-31T10:31:00.000+10:002004-03-31T10:58:09.090+10:00

Sometimes the best way to get something right is by getting it wrong, right? Right: A story headlined 'Syria seeks our help to woo US' in Saturday's Weekend Australian misquoted National Party senator Sandy Macdonald. The quote stated: "Syria is a country that has been a bastard state for nearly 40 years" but should have read "Syria is a country that has been a Baathist state for nearly 40

TimThttp://www.blogger.com/profile/10333303180015967125noreply@blogger.comtag:blogger.com,1999:blog-6346673.post-1080368590089290322004-03-27T17:19:00.000+11:002004-03-27T17:27:49.263+11:00

Welcome Sithmonkey to the Blogosphere, and please check out his delicious recipes for Ewok!

TimThttp://www.blogger.com/profile/10333303180015967125noreply@blogger.comtag:blogger.com,1999:blog-6346673.post-1080304097921865502004-03-26T23:09:00.000+11:002004-03-26T23:35:45.950+11:00

Here's a letter which caught my eye from yesterday's Newcastle Herald: From Scott Hillard Like most anti-abortionists, John Dunleavy (Short Takes 23/3) is not a woman of child-bearing age. John Dunleavy is not a woman. That's true. Men like Tony Abbott and Mr. Dunleavy... Tony Abbott and John Dunleavy are men? That's true too. ... along with Margaret Tighe of the "Right to Life"

TimThttp://www.blogger.com/profile/10333303180015967125noreply@blogger.comtag:blogger.com,1999:blog-6346673.post-1080302029646409212004-03-26T22:16:00.000+11:002004-03-26T23:37:22.780+11:00

Judging from some local news reports, the Not In My Backyard Crowd are now worrying about other people's backyards. Item One. Green Plight has owner seeing red Maitland businessman Craig Richards is calling for "green peace". The owner of Maitland Wholesale Windscreens and Tinting, Mr. Richards is at war with Maitland City Council over the colour of his High Street Business, which is lime

TimThttp://www.blogger.com/profile/10333303180015967125noreply@blogger.comtag:blogger.com,1999:blog-6346673.post-1080299280257927232004-03-26T21:51:00.000+11:002004-03-26T22:11:30.483+11:00

Interesting to see that Surfing Women's Champion Layne Beachley went up against Surfing Men's Champion Andy Irons today at Newcastle beach: WORLD CHAMPIONS MAKE SHOCK EXIT AT ENERGYAUSTRALIA OPEN TWO rising surf stars upstaged the reigning world men's and women's professional champions in the $100,000 EnergyAustralia Open. Bede Durbidge from Queensland and Bernado Pigmeau from Brazil

TimThttp://www.blogger.com/profile/10333303180015967125noreply@blogger.comtag:blogger.com,1999:blog-6346673.post-1080133875457786172004-03-24T23:49:00.000+11:002004-03-25T00:14:43.076+11:00

The Bunyip suggests an amusing pastime for the weekend. That Satan sure is evil - falsifying statistics an' all.

TimThttp://www.blogger.com/profile/10333303180015967125noreply@blogger.comtag:blogger.com,1999:blog-6346673.post-1080113041491433742004-03-24T18:03:00.000+11:002004-03-24T18:35:38.716+11:00

Letter in the Herald today: If, as Israeli propagandists assert, Sheik Yassin is Hamas's bin Laden, then Ariel Sharon is its recruitment officer. Colin Andersen, Lapstone, March 23 Now everything has been explained: not only is Sheik Yassin Hamas's bin Laden and Ariel Sharon it's recruiter, but Bush is Hitler, Kabul is the new Prague, and Iraq is both Vietnam and the Suez. Not to mention

TimThttp://www.blogger.com/profile/10333303180015967125noreply@blogger.comtag:blogger.com,1999:blog-6346673.post-1080111733384437952004-03-24T17:58:00.000+11:002004-03-24T18:42:14.293+11:00

Back again. This time, Telstra seem to have fixed my line, but it took them long enough. So long, in fact, that I was able to write the whole tale of my dealings with Telstra in verse... A Tale of Telstra When your home telephone has got no dial-tone And you can’t get the net up at all Then you fret and you frown and you start feeling down And you decide to give Telstra a call. So you

TimThttp://www.blogger.com/profile/10333303180015967125noreply@blogger.comtag:blogger.com,1999:blog-6346673.post-1079585774730232112004-03-18T15:50:00.000+11:002004-03-18T15:59:32.983+11:00

March 15 was International Eat an Animal for PETA day. In honour of this occasion, I invite all readers to sup on a pup - and I don't mean of the Hot-Dog variety. (And I know this post is four days too late. Would have posted it earlier, but ... see below.)

TimThttp://www.blogger.com/profile/10333303180015967125noreply@blogger.comtag:blogger.com,1999:blog-6346673.post-1079584983582493312004-03-18T15:41:00.000+11:002004-03-18T15:46:37.420+11:00

I still have dial-up problems. While they're getting fixed posting will be light and low.

TimThttp://www.blogger.com/profile/10333303180015967125noreply@blogger.comtag:blogger.com,1999:blog-6346673.post-1079328405647341952004-03-15T16:16:00.000+11:002004-03-15T16:36:00.093+11:00

The Sydney Morning Herald offers another view on The President Versus David Hicks, mentioned in the previous post. The Australian Guantanamo Bay captive David Hicks occupied himself in jail by killing mice, it has been reported. Mr Hicks, 28, who is awaiting a US military commission, reportedly went to desperate measures to maintain his sanity. It is not known what the mouse community

TimThttp://www.blogger.com/profile/10333303180015967125noreply@blogger.comtag:blogger.com,1999:blog-6346673.post-1079158718322195802004-03-13T16:59:00.000+11:002004-03-13T17:21:50.326+11:00

"It will sound silly," writes Stephen Romei, in a review of The President Versus David Hicks, screening this Wednesday on SBS television, ... but it repulses me to learn, from a former Guantanamo Bay inmate, that Hicks passes the time by catching mice and hanging them. Doesn't sound silly to me at all. Interestingly, Romei is no Right-winger; he 'despises' the 'arrogance that governs the US

TimThttp://www.blogger.com/profile/10333303180015967125noreply@blogger.comtag:blogger.com,1999:blog-6346673.post-1079157162253495292004-03-13T16:36:00.000+11:002004-03-13T16:55:53.746+11:00

Some other responses to the Madrid bombings: Tim Blair: Well done, terrorists. You’ve successfully not terrified anybody. Golan and Franco Alemán from HispaLibertas: The images and testimonies that we’ve been watching are absolutely heart wrecking. Last night some of the people who were working in the mass morgue that was improvised in a convention center needed medical sedation because they

TimThttp://www.blogger.com/profile/10333303180015967125noreply@blogger.comtag:blogger.com,1999:blog-6346673.post-1079155928625357582004-03-13T16:02:00.000+11:002004-03-13T16:59:15.233+11:00

We all know the facts: 10 simultaneous bomb-blasts in trains in Madrid. At least 199 people dead, 1,400 more injured, many in a critical condition. It's mass murder - plain and simple. Follow the story here, and here. We're still not sure who is responsible - at the moment it's a toss up between Al-Qaeda and ETA. But, for the letter writers at the SMH, the response to the events has been

TimThttp://www.blogger.com/profile/10333303180015967125noreply@blogger.comtag:blogger.com,1999:blog-6346673.post-1079096244587277172004-03-12T23:42:00.000+11:002004-03-13T00:01:36.420+11:00

And the award for Blatant Self-Congratulation goes this year to - the UK Award Industry! The first awards ceremony for people who organise awards is being held on Friday, and it's not a spoof. Why is it that even the gong industry needs gongs? The Awards Awards, at London's Dorchester Hotel, is a chance for the cream of the UK's award industry - the gongerati, if you will - to give

TimThttp://www.blogger.com/profile/10333303180015967125noreply@blogger.comtag:blogger.com,1999:blog-6346673.post-1079008985298109172004-03-11T22:52:00.000+11:002004-03-11T23:46:14.590+11:00

A list of 'nonlethal weapons', many still in the proposed stage, from an United States Air Force Institute for National Security Studies report. Found at the Harper's magazine website. A small taste of what's on offer: Photic Driver: A crowd-control device that uses ultrasound and flashing infrared lights to penetrate closed human eyelids. Potential for epileptic fits because of the

TimThttp://www.blogger.com/profile/10333303180015967125noreply@blogger.comtag:blogger.com,1999:blog-6346673.post-1078988517698048802004-03-11T17:08:00.000+11:002004-03-11T18:18:32.903+11:00

Grand Mufti Sheikh al-Hilaly: extremist or moderate? You be the judge... From the Australian, January of this year: IT'S a colourful book that sits on a shelf in the country's largest Islamic bookshop deep in the southwestern suburbs of Sydney. But unlike much of the texts surrounding it, Jihad and Jurisprudence is considered by moderate Muslims to pose a danger to society. Inside,

TimThttp://www.blogger.com/profile/10333303180015967125noreply@blogger.comtag:blogger.com,1999:blog-6346673.post-1078985251741915502004-03-11T17:05:00.000+11:002004-03-11T17:11:20.780+11:00

Had problems with my phone line so wasn't able to blog for a couple of days. Back now.

TimThttp://www.blogger.com/profile/10333303180015967125noreply@blogger.comtag:blogger.com,1999:blog-6346673.post-1078555440417340442004-03-06T17:40:00.000+11:002004-03-06T17:47:02.500+11:00

Just further to that last post. Leonore Dvorkin had to get her breast amputated. I've always wondered, what do the doctors do with the amputated body part afterwards? Give it to the owner? Keep it and file it away? Throw it out? Sell it to the cat-food company down the road? Mail your suggestions through to me!

TimThttp://www.blogger.com/profile/10333303180015967125noreply@blogger.comtag:blogger.com,1999:blog-6346673.post-1078554765179367312004-03-06T17:25:00.000+11:002004-03-06T17:36:27.030+11:00

An ad on Tim Blair's sidebar links to this book, titled 'Why I'm Glad I Had Breast Cancer', by Leonore Dvorkin. Perhaps I could try writing a book in a similar vein. How about: 'Bubonic Plague for Fun and Profit'?

TimThttp://www.blogger.com/profile/10333303180015967125noreply@blogger.comtag:blogger.com,1999:blog-6346673.post-1078490356098942912004-03-05T23:24:00.000+11:002004-03-05T23:48:06.340+11:00

Poor old Uli Schmetzer. All he did was take a spurious quote and attribute it to a non-existent person. He just wanted to fill his column space! He didn't want this to happen... This seems to be happening an awful lot nowadays. First Jayson Blair, now Uli Schmetzer. Maybe these guys should form a Union - you know, the Union of Bullshit Artists, standing up for the rights of hacks everywhere in

TimThttp://www.blogger.com/profile/10333303180015967125noreply@blogger.comtag:blogger.com,1999:blog-6346673.post-1078489063899740162004-03-05T23:05:00.000+11:002004-03-05T23:20:45.360+11:00

Seems there have been some demonic manifestations during the making of The Passion of the Christ: John Debney, who composed the music for The Passion of the Christ, has told the US Christian news agency Assist News Service that he was visited by the devil - via his computer - while writing the score. "The first time . . . it scared me," he said. "Once I got over the initial shock, I learned

TimThttp://www.blogger.com/profile/10333303180015967125noreply@blogger.comtag:blogger.com,1999:blog-6346673.post-1078403194056670792004-03-04T23:13:00.000+11:002004-03-05T22:53:53.936+11:00

Quick, chop down the rainforests now before they produce any more carbon dioxide! Eh? What's that? Trees produce oxygen? Which we need to survive? Ha! Show's how much you know! Trees might do that, on their own ... but in this week's edition of Catalyst, Science Reporter Paul Willis looks at research in the Australian Daintree forest showing it producing more Carbon Dioxide than it

TimThttp://www.blogger.com/profile/10333303180015967125noreply@blogger.comtag:blogger.com,1999:blog-6346673.post-1078360195936965892004-03-04T11:25:00.000+11:002004-03-04T11:32:55.090+11:00

Remember this post? America's oldest man dies at 114 Why am I not surprised? America's oldest man has died: so what? What did they expect him to do? Fly to the moon? Take up yodelling as a pastime? Tap dance over the Himalayas? Continue living indefinitely? Well, it turns out he wasn't that old at all. He was a positively youthful 92 years old: But U.S. Census records indicate that

TimThttp://www.blogger.com/profile/10333303180015967125noreply@blogger.comtag:blogger.com,1999:blog-6346673.post-1078359784117483362004-03-04T11:09:00.000+11:002004-03-04T11:26:03.360+11:00

17,000 scientists say no: There is no convincing scientific evidence that human release of carbon dioxide, methane, or other greenhouse gasses is causing or will, in the foreseeable future, cause catastrophic heating of the Earth's atmosphere and disruption of the Earth's climate. Moreover, there is substantial scientific evidence that increases in atmospheric carbon dioxide produce many

TimThttp://www.blogger.com/profile/10333303180015967125noreply@blogger.comtag:blogger.com,1999:blog-6346673.post-1078358930027693132004-03-04T10:53:00.000+11:002004-03-06T17:43:21.700+11:00

It's time to take issue with a really big issue, a really important issue, an issue that is so fundamental that ... we haven't even heard about it in Australia yet. That issue is ... gay marriage. I don't have an opinion about it myself, and you probably don't either, but here are three useful opinions for starters: Andrew Sullivan is for gay marriage... The Bunyip has no problems with gays

TimThttp://www.blogger.com/profile/10333303180015967125noreply@blogger.comtag:blogger.com,1999:blog-6346673.post-1078357962610179122004-03-04T10:40:00.000+11:002004-03-04T23:37:13.403+11:00

"I was 27, a postgraduate student at Yale in my last term, and then, as now, a man." writes Sam Schulman, beginning a heartbreaking tale of innocence lost in this week's Spectator: One day, walking along Temple Street, I saw Harold (Bloom) ambling towards me... I told him that I thought his lecture was beautiful. He stopped, and regarded me with his soft, yearning eyes. ‘My dear,’ he said, ‘

TimThttp://www.blogger.com/profile/10333303180015967125noreply@blogger.comtag:blogger.com,1999:blog-6346673.post-1078104856436721652004-03-01T12:14:00.000+11:002004-03-01T12:37:46.403+11:00

Was at an underground film night last night (as happens) and was chatting with some very nice vegans (as you do). The following exchange occurred: Vegan 1: "There's a cafe on Beaumont, they say they serve vegan lasagne." Vegan 2: "Oh?" Vegan 1: "Yeah. But the recipe reads lasagne with bolognese sauce - which is fine - but the sauce is sprinkled with parmesan!" Vegan 2: "Wooah, man,

TimThttp://www.blogger.com/profile/10333303180015967125noreply@blogger.comtag:blogger.com,1999:blog-6346673.post-1077964126400073292004-02-28T20:57:00.000+11:002004-02-28T21:33:13.590+11:00

An intriguing comments thread in Tim Blair's latest post: I ate skippy last night; wouldn't mind trying koala, but I reckon it'd be like mutton marinated in dencorub. I've been trying to find a good recipe for koala for a while now. I decided to hit Google (with a little help from www.ask.com) and see what I found. The most obvious entries - 'How to cook a koala', 'koala recipes' and 'eating

TimThttp://www.blogger.com/profile/10333303180015967125noreply@blogger.comtag:blogger.com,1999:blog-6346673.post-1077801828629181822004-02-27T00:01:00.000+11:002004-02-27T00:28:10.326+11:00

America's oldest man dies at 114 Why am I not surprised? America's oldest man has died: so what? What did they expect him to do? Fly to the moon? Take up yodelling as a pastime? Tap dance over the Himalayas? Continue living indefinitely? Dying is what old people do. The older the person, the easier it is. Dare I say it, it's an ability - a talent, if you will - ingrained in each and every

TimThttp://www.blogger.com/profile/10333303180015967125noreply@blogger.comtag:blogger.com,1999:blog-6346673.post-1077798535133350402004-02-26T23:06:00.000+11:002004-02-26T23:43:20.466+11:00

Over at The Spectator, Alexander Chancellor writes: When David Blunkett was in Delhi at the same time as me, he was quoted as saying that he was looking forward to ‘seeing’ the Taj Mahal. Last year, The Spectator published an interesting exchange between David Blunkett and reporters - Blunkett saying how he could "hear" the New York skyline. If a tree falls in the forest, and there's

TimThttp://www.blogger.com/profile/10333303180015967125noreply@blogger.comtag:blogger.com,1999:blog-6346673.post-1077797014997873442004-02-26T22:58:00.000+11:002004-03-01T12:40:30.466+11:00

Don't you think this headline is just a tad biased? Or am I a monkeys uncle? That article - with that headline - appeared on the front cover of the Newcastle Star today. I F&*^*^*&^&*&^$%)(&*ING HATE NIMBYS!

TimThttp://www.blogger.com/profile/10333303180015967125noreply@blogger.comtag:blogger.com,1999:blog-6346673.post-1077796567919845062004-02-26T22:47:00.000+11:002004-02-26T22:58:58.560+11:00

... Colin Keay says yes. I want my air-conditioner to be turned on or off by me, not by some distant load controller. I want to be on the end of a dependable electrical supply system where outages are non-existent. I want electrical energy to be on top for me, my family, and you, my listeners, whenever we need it. That happy state of affairs will prevail only if some long-term planning

TimThttp://www.blogger.com/profile/10333303180015967125noreply@blogger.comtag:blogger.com,1999:blog-6346673.post-1077795616174899702004-02-26T22:35:00.000+11:002004-02-26T23:41:21.640+11:00

Apparently, something infinitely small has just got infinitesimally smaller: Scientists say an instant is now shorter The length of an instant has just become shorter, according to scientists. And how did that happen? Well... Researchers in Austria and Germany measured the smallest time interval recorded, and found it lasted a ten million billionth of a second. It's about ten times

TimThttp://www.blogger.com/profile/10333303180015967125noreply@blogger.comtag:blogger.com,1999:blog-6346673.post-1077692769949089332004-02-25T17:45:00.000+11:002004-02-25T18:09:46.293+11:00

Oh no! Somebody wrote into the Green Left Weekly and accused the Cuban Government (ie, totalitarian dictatorship) of (gasp!) homophobia! I was glad to see the Socialist Alliance attend this year's Queer Pride March. It is important that the left continue to have a presence at the event. However, I was not impressed with your choice of banner. Taking a banner featuring Che Guevara to a queer

TimThttp://www.blogger.com/profile/10333303180015967125noreply@blogger.comtag:blogger.com,1999:blog-6346673.post-1077691403846462942004-02-25T17:40:00.000+11:002004-02-25T17:46:12.170+11:00

I’m looking for work. Anything, really. I can clock upwards of 80 words per minute on the keyboard, and am reasonably experienced in several computer programs. Oh - and I can answer the phone and operate the photocopier with the best of them. But apparently this isn’t what the employers are looking for, despite what they’re saying. In fact, the average job-advertisment is just as bad as the

TimThttp://www.blogger.com/profile/10333303180015967125noreply@blogger.comtag:blogger.com,1999:blog-6346673.post-1077626966397143952004-02-24T23:46:00.000+11:002004-02-24T23:58:04.950+11:00

So, who wants to hop in the Trabant and go for a trip back in time to East Germany, the old East Germany of the Stasi and the Berlin wall, of communism for all and riches for nobody? Me neither. But I did get along to see Goodbye Lenin with Mum today... The film, set in this old East Germany, is about Alex and his idealistic communist mother. When Alex’s mum sees him being taken away by

TimThttp://www.blogger.com/profile/10333303180015967125noreply@blogger.comtag:blogger.com,1999:blog-6346673.post-1077374498097407702004-02-22T01:38:00.000+11:002004-02-22T01:44:21.593+11:00

Sproing! Moooooooooooooooooooooooooooooooo! Plonk! Sproing! Moooooooooooooooooooooooooooooooo! Plonk!

TimThttp://www.blogger.com/profile/10333303180015967125noreply@blogger.comtag:blogger.com,1999:blog-6346673.post-1077372715641528762004-02-22T00:39:00.000+11:002004-02-22T01:46:39.610+11:00

A friend told me yesterday that there was going to be a new character on Sesame Street, a monster called HIV, who has the AIDS virus. As it turns out, this is pretty old news - I found an Ananova report dating back to 2002, and the character appeared on the South African version of Sesame Street, not the American version - but it set me thinking: why stop there? If you want to educate kids

TimThttp://www.blogger.com/profile/10333303180015967125noreply@blogger.comtag:blogger.com,1999:blog-6346673.post-1077370735968531182004-02-22T00:16:00.000+11:002004-02-22T00:41:39.420+11:00

There are many sights to see around Newcastle. There are many coal-mines which supply material to local, national and international power stations. Not only do they help to provide base-load power for the rest of the state, but they also provide jobs for hundreds of locals, and they annoy local environmentalists. The Kooragang Island wind turbine doesn't work very well, but it looks pretty.

TimThttp://www.blogger.com/profile/10333303180015967125noreply@blogger.comtag:blogger.com,1999:blog-6346673.post-1077323531223049252004-02-21T11:27:00.000+11:002004-02-21T11:34:53.996+11:00

In the SMH this morning: Shirley MacLaine has co-authored a book with her pooch. I feel a bad joke coming on: Is this woman absolutely barking mad?!?

TimThttp://www.blogger.com/profile/10333303180015967125noreply@blogger.comtag:blogger.com,1999:blog-6346673.post-1077278051813262242004-02-20T22:46:00.000+11:002004-02-20T22:56:53.450+11:00

Tim Blair links to this story about Oxford engineering student Matthew Richardson who caught a plane to China in order to give a series of talks - about economics! Here is my own poetic tribute to this plucky young chap: From Oxford he came – Matthew was his name – The best of Britannia’s breed – And he caught an airliner into darkest China To spread the free-traders creed, Yes, to

TimThttp://www.blogger.com/profile/10333303180015967125noreply@blogger.comtag:blogger.com,1999:blog-6346673.post-1077237804441669902004-02-20T11:38:00.000+11:002004-02-20T11:46:05.576+11:00

WTF? I'm trying to work out what this site is all about. It's called 'Cthulhu coffee' and here's the explanation they offer: If you're really confused about what this site is all about, here's a quick dictionary: Cthulhu, the Utimate evil Coffee, the Utimate drink Whatever it is about, I like. Muchly.

TimThttp://www.blogger.com/profile/10333303180015967125noreply@blogger.comtag:blogger.com,1999:blog-6346673.post-1077179520010727852004-02-19T19:14:00.000+11:002004-02-19T22:06:48.780+11:00

A particularly stupid idea: The Lord Mayors of Wollongong, Newcastle and Parramatta have put their support behind a move to establish free CBD bus loop services in their cities. I use public transport a lot, so I can vouch for the fact that it suffers from the same problems as any other over-subsidised public-sector organisation: it never has enough money. The $2.50 (or $1.25 concession) fare

TimThttp://www.blogger.com/profile/10333303180015967125noreply@blogger.comtag:blogger.com,1999:blog-6346673.post-1077178433710039742004-02-19T19:11:00.000+11:002004-02-19T22:11:29.826+11:00

From the latest edition of Viz: Wanquility: The all too brief post masturbatory period of serenity experienced immediately before the loathing, self-hatred and shame sets in.

TimThttp://www.blogger.com/profile/10333303180015967125noreply@blogger.comtag:blogger.com,1999:blog-6346673.post-1077177026380654312004-02-19T18:34:00.000+11:002004-02-19T22:04:52.466+11:00

Politics all over the world splits into two main factions - Left-wing and Right-wing. In Australia, the Left-wing is represented by the Australian Labor Party and the Right-wing is represented by the Liberal Party. However, Labor and the Liberals are further split into sub-factions. So, there is a Labor left (or the Left-left faction), a Labor right (or the Left-right faction), a Labor-centre

TimThttp://www.blogger.com/profile/10333303180015967125noreply@blogger.comtag:blogger.com,1999:blog-6346673.post-1077175695215463922004-02-19T17:48:00.000+11:002004-02-19T22:21:46.483+11:00

Hey! It's time to play Mix the Metaphors with former Prime Minister Paul Keating! Writing in the SMH today, Keating says that ... he says ... well, you tell me what he says: I think we've always believed in the invincibility of Sydney's physicality. R-i-i-ight. That the sheer scope of natural beauty could absorb development, particularly of the slow-moving kind. In the now head-long speed

TimThttp://www.blogger.com/profile/10333303180015967125noreply@blogger.comtag:blogger.com,1999:blog-6346673.post-1077145634211503702004-02-19T09:53:00.000+11:002004-02-19T18:56:44.890+11:00

Take a look at this poster over at Protest Warrior. It's funny and thought provoking, and it's a neat reminder that sometimes, the worst sort of racism can come from the Left. Well, I decided to do my own, Australian version: White Racists, Vote for the Left!!! - We oppose Free Trade with other countries. Keep Australian Jobs for Australian workers. Why should those dirty Pakis and greasy

TimThttp://www.blogger.com/profile/10333303180015967125noreply@blogger.comtag:blogger.com,1999:blog-6346673.post-1077064456737104842004-02-18T10:34:00.000+11:002004-02-18T11:36:55.263+11:00

Here's a newsflash for the Australian newsmedia: Australians are not Americans and Americans are not Australians. We don't vote in their elections and they sure as hell don't vote in ours. So why do we go crazy every time there is a presidential election in America? I don't care who Kerry went to bed with or didn't go to bed with, and I care even less what Bush did as a member of the Air Force

TimThttp://www.blogger.com/profile/10333303180015967125noreply@blogger.comtag:blogger.com,1999:blog-6346673.post-1076992431994881362004-02-17T15:24:00.000+11:002004-02-17T15:59:04.263+11:00

The Ubernerdling, local scientific genius and editor of fantastic science-zine Nerdling, has just published a wonderful, informative booklet on Nuclear energy. Find it here. (Warning: the document is in PDF, so you'll might have to wait a while for it to download.) Included: - Helpful advice on building your own homemade Breeder reactor (and neutron-ray!) - A handy guide to help you

TimThttp://www.blogger.com/profile/10333303180015967125noreply@blogger.comtag:blogger.com,1999:blog-6346673.post-1076991793955150412004-02-17T15:15:00.000+11:002004-02-17T15:47:10.530+11:00

I've just been reading some poetry by Tennyson. God, those romantics were depressed! Dark house, by which once more I stand Here in the long unlovely street, Doors, where my heart was used to beat So quickly, waiting for a hand, A hand that can be clasped no more - Behold me, for I cannot sleep, And like a guilty thing I creep At earliest morning to the door. He is not here; but

TimThttp://www.blogger.com/profile/10333303180015967125noreply@blogger.comtag:blogger.com,1999:blog-6346673.post-1076991039407351762004-02-17T14:37:00.000+11:002004-02-17T15:17:56.733+11:00

The headline says it all: Britain calls inquiry into why it calls so many inquiries EVERY disaster sparks an inquiry these days; so do political ructions, murders and, increasingly, other inquiries. This week, Britain's Public Administration Committee thrashed out what a literary critic might call a meta-inquiry: an investigation into how and why the Government calls so many of the things. I

TimThttp://www.blogger.com/profile/10333303180015967125noreply@blogger.comtag:blogger.com,1999:blog-6346673.post-107675604419409882004-02-14T21:46:00.000+11:002004-02-17T15:59:43.840+11:00

This blog is about: Poetry, people, philosophy, politics, life, literature, art, cartoons, science, skepticism, chess, television, films, the environment, environmentalists and their weird enviro-mentalities, and ... anything else I feel like talking about. Enjoy!

TimThttp://www.blogger.com/profile/10333303180015967125noreply@blogger.com